ID: 939144414

View in Genome Browser
Species Human (GRCh38)
Location 2:138395659-138395681
Sequence TCTATGCCAGGGCATGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939144414_939144421 -2 Left 939144414 2:138395659-138395681 CCTCTCCCATGCCCTGGCATAGA No data
Right 939144421 2:138395680-138395702 GAGAGAATATGTGTGTTGTGGGG No data
939144414_939144423 21 Left 939144414 2:138395659-138395681 CCTCTCCCATGCCCTGGCATAGA No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data
939144414_939144419 -4 Left 939144414 2:138395659-138395681 CCTCTCCCATGCCCTGGCATAGA No data
Right 939144419 2:138395678-138395700 TAGAGAGAATATGTGTGTTGTGG No data
939144414_939144422 20 Left 939144414 2:138395659-138395681 CCTCTCCCATGCCCTGGCATAGA No data
Right 939144422 2:138395702-138395724 GAGAGAGACTGCAGTGACTGTGG No data
939144414_939144420 -3 Left 939144414 2:138395659-138395681 CCTCTCCCATGCCCTGGCATAGA No data
Right 939144420 2:138395679-138395701 AGAGAGAATATGTGTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939144414 Original CRISPR TCTATGCCAGGGCATGGGAG AGG (reversed) Intergenic
No off target data available for this crispr