ID: 939144415

View in Genome Browser
Species Human (GRCh38)
Location 2:138395664-138395686
Sequence TTCTCTCTATGCCAGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939144415_939144419 -9 Left 939144415 2:138395664-138395686 CCCATGCCCTGGCATAGAGAGAA No data
Right 939144419 2:138395678-138395700 TAGAGAGAATATGTGTGTTGTGG No data
939144415_939144421 -7 Left 939144415 2:138395664-138395686 CCCATGCCCTGGCATAGAGAGAA No data
Right 939144421 2:138395680-138395702 GAGAGAATATGTGTGTTGTGGGG No data
939144415_939144420 -8 Left 939144415 2:138395664-138395686 CCCATGCCCTGGCATAGAGAGAA No data
Right 939144420 2:138395679-138395701 AGAGAGAATATGTGTGTTGTGGG No data
939144415_939144424 28 Left 939144415 2:138395664-138395686 CCCATGCCCTGGCATAGAGAGAA No data
Right 939144424 2:138395715-138395737 GTGACTGTGGGACTTTTCCTTGG No data
939144415_939144422 15 Left 939144415 2:138395664-138395686 CCCATGCCCTGGCATAGAGAGAA No data
Right 939144422 2:138395702-138395724 GAGAGAGACTGCAGTGACTGTGG No data
939144415_939144423 16 Left 939144415 2:138395664-138395686 CCCATGCCCTGGCATAGAGAGAA No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939144415 Original CRISPR TTCTCTCTATGCCAGGGCAT GGG (reversed) Intergenic
No off target data available for this crispr