ID: 939144416

View in Genome Browser
Species Human (GRCh38)
Location 2:138395665-138395687
Sequence ATTCTCTCTATGCCAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939144416_939144424 27 Left 939144416 2:138395665-138395687 CCATGCCCTGGCATAGAGAGAAT No data
Right 939144424 2:138395715-138395737 GTGACTGTGGGACTTTTCCTTGG No data
939144416_939144420 -9 Left 939144416 2:138395665-138395687 CCATGCCCTGGCATAGAGAGAAT No data
Right 939144420 2:138395679-138395701 AGAGAGAATATGTGTGTTGTGGG No data
939144416_939144421 -8 Left 939144416 2:138395665-138395687 CCATGCCCTGGCATAGAGAGAAT No data
Right 939144421 2:138395680-138395702 GAGAGAATATGTGTGTTGTGGGG No data
939144416_939144419 -10 Left 939144416 2:138395665-138395687 CCATGCCCTGGCATAGAGAGAAT No data
Right 939144419 2:138395678-138395700 TAGAGAGAATATGTGTGTTGTGG No data
939144416_939144422 14 Left 939144416 2:138395665-138395687 CCATGCCCTGGCATAGAGAGAAT No data
Right 939144422 2:138395702-138395724 GAGAGAGACTGCAGTGACTGTGG No data
939144416_939144423 15 Left 939144416 2:138395665-138395687 CCATGCCCTGGCATAGAGAGAAT No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939144416 Original CRISPR ATTCTCTCTATGCCAGGGCA TGG (reversed) Intergenic
No off target data available for this crispr