ID: 939144417

View in Genome Browser
Species Human (GRCh38)
Location 2:138395670-138395692
Sequence CACATATTCTCTCTATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939144417_939144422 9 Left 939144417 2:138395670-138395692 CCCTGGCATAGAGAGAATATGTG No data
Right 939144422 2:138395702-138395724 GAGAGAGACTGCAGTGACTGTGG No data
939144417_939144424 22 Left 939144417 2:138395670-138395692 CCCTGGCATAGAGAGAATATGTG No data
Right 939144424 2:138395715-138395737 GTGACTGTGGGACTTTTCCTTGG No data
939144417_939144423 10 Left 939144417 2:138395670-138395692 CCCTGGCATAGAGAGAATATGTG No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939144417 Original CRISPR CACATATTCTCTCTATGCCA GGG (reversed) Intergenic
No off target data available for this crispr