ID: 939144418

View in Genome Browser
Species Human (GRCh38)
Location 2:138395671-138395693
Sequence ACACATATTCTCTCTATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939144418_939144422 8 Left 939144418 2:138395671-138395693 CCTGGCATAGAGAGAATATGTGT No data
Right 939144422 2:138395702-138395724 GAGAGAGACTGCAGTGACTGTGG No data
939144418_939144423 9 Left 939144418 2:138395671-138395693 CCTGGCATAGAGAGAATATGTGT No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data
939144418_939144424 21 Left 939144418 2:138395671-138395693 CCTGGCATAGAGAGAATATGTGT No data
Right 939144424 2:138395715-138395737 GTGACTGTGGGACTTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939144418 Original CRISPR ACACATATTCTCTCTATGCC AGG (reversed) Intergenic
No off target data available for this crispr