ID: 939144423

View in Genome Browser
Species Human (GRCh38)
Location 2:138395703-138395725
Sequence AGAGAGACTGCAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939144414_939144423 21 Left 939144414 2:138395659-138395681 CCTCTCCCATGCCCTGGCATAGA No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data
939144416_939144423 15 Left 939144416 2:138395665-138395687 CCATGCCCTGGCATAGAGAGAAT No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data
939144415_939144423 16 Left 939144415 2:138395664-138395686 CCCATGCCCTGGCATAGAGAGAA No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data
939144418_939144423 9 Left 939144418 2:138395671-138395693 CCTGGCATAGAGAGAATATGTGT No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data
939144417_939144423 10 Left 939144417 2:138395670-138395692 CCCTGGCATAGAGAGAATATGTG No data
Right 939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939144423 Original CRISPR AGAGAGACTGCAGTGACTGT GGG Intergenic
No off target data available for this crispr