ID: 939146899

View in Genome Browser
Species Human (GRCh38)
Location 2:138426289-138426311
Sequence GGGGGCGCTGCAGGAGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1420
Summary {0: 15, 1: 62, 2: 162, 3: 535, 4: 646}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939146899_939146913 29 Left 939146899 2:138426289-138426311 CCCTGGTCTCCTGCAGCGCCCCC 0: 15
1: 62
2: 162
3: 535
4: 646
Right 939146913 2:138426341-138426363 TGGCGAAATTCTAGTCAGACCGG No data
939146899_939146906 -5 Left 939146899 2:138426289-138426311 CCCTGGTCTCCTGCAGCGCCCCC 0: 15
1: 62
2: 162
3: 535
4: 646
Right 939146906 2:138426307-138426329 CCCCCAGGCTTGTTAGGATTGGG 0: 12
1: 115
2: 129
3: 342
4: 850
939146899_939146910 9 Left 939146899 2:138426289-138426311 CCCTGGTCTCCTGCAGCGCCCCC 0: 15
1: 62
2: 162
3: 535
4: 646
Right 939146910 2:138426321-138426343 AGGATTGGGAAATTCCAGCCTGG 0: 134
1: 223
2: 87
3: 59
4: 189
939146899_939146904 -6 Left 939146899 2:138426289-138426311 CCCTGGTCTCCTGCAGCGCCCCC 0: 15
1: 62
2: 162
3: 535
4: 646
Right 939146904 2:138426306-138426328 GCCCCCAGGCTTGTTAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939146899 Original CRISPR GGGGGCGCTGCAGGAGACCA GGG (reversed) Intergenic
900040968 1:464206-464228 GGTGGAGCTGCCTGAGACCATGG - Intergenic
900062397 1:699182-699204 GGTGGAGCTGCCTGAGACCATGG - Intergenic
900402270 1:2477439-2477461 GGGGGCGTTGTAGAGGACCAAGG - Intronic
900460906 1:2801767-2801789 CGGGGCGCTGCAGGACAGCCAGG - Intergenic
900466347 1:2827280-2827302 GGGGGCCTCCCAGGAGACCAAGG + Intergenic
900748938 1:4381625-4381647 GAGGGTACTGCAGGAGACCAGGG + Intergenic
900810487 1:4798068-4798090 GGGTGCTCTCCAGGAGAGCAAGG + Intergenic
900936130 1:5767281-5767303 GGGGGCGCTGCCGGAGACTAGGG + Intergenic
901458631 1:9378166-9378188 GGGACGGCTGCAGGAGACCCAGG - Intergenic
902382720 1:16060164-16060186 GGGGGCACTGATGGAGATCATGG - Intronic
902451369 1:16498955-16498977 GGGGGCGCGACAGGAGGCCGAGG - Intergenic
902570054 1:17341606-17341628 AGGGGCACAGCAGGGGACCAGGG - Intronic
902964566 1:19990251-19990273 GGGAGTGCTACAGGAGACCAAGG - Intergenic
902996913 1:20232786-20232808 GAGGGTACTGCAGGAGACCAGGG + Intergenic
903128440 1:21263051-21263073 GGGAGGGCGGGAGGAGACCAGGG + Intronic
904893486 1:33796938-33796960 GAGGGTACTGCAGGAGACCAGGG - Intronic
905011173 1:34747972-34747994 GGTGGCGCTTCAGGAGATCAGGG - Intronic
905772030 1:40644601-40644623 GAGGGGGCTGCAGGAGTCCATGG + Intronic
906577148 1:46901316-46901338 GAGGGTACTGCAGGAGACCAGGG - Intergenic
906577921 1:46907628-46907650 GAGGGTACTGCAGGAGACCAGGG - Intergenic
906840582 1:49134390-49134412 GGGGGCACTGCAGGAGACTAGGG + Intronic
907988808 1:59558749-59558771 TAGGGTACTGCAGGAGACCAGGG + Intronic
908761239 1:67513853-67513875 GAGGGTACTGCAGGAGACCAGGG - Intergenic
909082850 1:71134606-71134628 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
909352454 1:74670981-74671003 GAGGGTACTGCAGGAGACCAGGG - Intronic
909604306 1:77493313-77493335 GGGGGGGCTGCTGGTGTCCAAGG - Intronic
909749267 1:79138326-79138348 GGGGGTGCTGCAGGAGGCCAGGG - Intergenic
909756360 1:79230914-79230936 GAGGGTACTGCAGGAGACCAGGG - Intergenic
909812899 1:79953643-79953665 GGGAGCACTACAGGAGACCAGGG + Intergenic
909824573 1:80111081-80111103 GAGGATACTGCAGGAGACCAGGG + Intergenic
910073794 1:83251812-83251834 GAGGGTACTGCAGGAGACCAGGG + Intergenic
910162369 1:84287624-84287646 GAGGGCACTGCAGGAGACCGGGG - Intergenic
910301849 1:85714684-85714706 AAGGGCGCTGCAGGAGACCAGGG + Intergenic
910605591 1:89080276-89080298 GGGAGCGCTACGGGAGACCGGGG - Intergenic
910638776 1:89438515-89438537 GAGGGTACTGCAGGAGACCAGGG - Intergenic
910833532 1:91484256-91484278 GGGAGCACTGCAGGAGACTGGGG + Intergenic
910957596 1:92723927-92723949 GAGGGTACTGCAGGAGACCAGGG - Intronic
911030225 1:93479500-93479522 GAGGGTACTGCAGGAGACCAGGG + Intronic
911071261 1:93833478-93833500 GGGAGCGCTGCAGGAGACCAGGG + Intronic
911083054 1:93952135-93952157 GGGAGCGCTACGGGAGACTAGGG + Intergenic
911249314 1:95557216-95557238 GAGGGTACTGCAGGAGACCAGGG - Intergenic
911487972 1:98526213-98526235 GAGGGTACTGCAGGAGACCAGGG + Intergenic
911591968 1:99758918-99758940 GAGGGTACTGCAGGAGACCAGGG - Intronic
911638626 1:100264310-100264332 GAGGGTACTGCAGGAGACCAGGG - Intergenic
911826848 1:102497987-102498009 GAGGGTGCTGCAGGAGACCAGGG - Intergenic
911831318 1:102554163-102554185 GAGGGTACTGCAGGAGACCAGGG - Intergenic
911940799 1:104044977-104044999 GGGAGCGCTACAGGAGACTGGGG + Intergenic
912038377 1:105351686-105351708 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
912097343 1:106161595-106161617 GGGGGCGCTGCAGGAGGCCAGGG - Intergenic
912112360 1:106358655-106358677 GAAGGTACTGCAGGAGACCAGGG + Intergenic
912297670 1:108486193-108486215 GAGGGCACTGCAGGAGACCAGGG - Intergenic
912439060 1:109684725-109684747 GAGGGTACTGCAGGAGACCGGGG - Intronic
912441581 1:109703170-109703192 GAGGGTACTGCAGGAGACCAGGG - Intronic
912442368 1:109709172-109709194 GAGGGTACTGCAGGAGACCAGGG - Intronic
912520989 1:110244544-110244566 GGTGGCGCTGCTGGTGATCAGGG - Intronic
912712939 1:111962419-111962441 GGGGGAGCTGCAGAAGGCCTAGG + Intronic
913355997 1:117922878-117922900 GGGGGCGTTGCAGGAGACTAGGG + Intronic
913402787 1:118454853-118454875 GGTGGAGCTGCACAAGACCATGG - Intergenic
913996739 1:143656877-143656899 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
913999222 1:143678651-143678673 TGGGATGCTCCAGGAGACCAGGG + Intergenic
914214938 1:145617093-145617115 GAGGGCACTGTAGGAGACCAGGG + Intronic
914466882 1:147937487-147937509 GAGGGCACTGTAGGAGACCAGGG + Intronic
914505516 1:148285925-148285947 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
914507046 1:148298226-148298248 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
914704425 1:150159403-150159425 GAGGGTGCTGCAGGAGGTCAGGG + Exonic
914803046 1:150974438-150974460 GGGGGCGCTGCGGGCGCTCATGG - Intronic
914877743 1:151524916-151524938 GAGGGCACTGCTGGAGAACAAGG + Intronic
915097293 1:153472236-153472258 GAGGGTACTGCAGGAGACCAGGG - Intergenic
915342447 1:155184040-155184062 GGGGGCACTCCAAGAGCCCACGG - Exonic
915403629 1:155642657-155642679 GAAGGTACTGCAGGAGACCAGGG + Intergenic
915410489 1:155697824-155697846 GAGGGTGCTGCAGGAGACCAGGG + Intronic
915817172 1:158980596-158980618 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
916122051 1:161537328-161537350 GAGGGTACTGCAGGAGACCAGGG - Intergenic
916131941 1:161618753-161618775 GAGGGTACTGCAGGAGACCAGGG - Intronic
917078902 1:171236580-171236602 GAGGGTACTGCAGGAGACCAGGG + Intergenic
917209893 1:172620762-172620784 GAGGGCACTGCAGGAGACCAGGG + Intergenic
917278158 1:173352788-173352810 GGGGGTGCTGCAGGAGGCCAGGG + Intergenic
917381122 1:174409768-174409790 GAGGGTACGGCAGGAGACCAGGG - Intronic
917588375 1:176451878-176451900 GAGGGTACTGCAGGAGACCAGGG - Intergenic
917765194 1:178208435-178208457 GAGGGTACTGCAGAAGACCAGGG - Intronic
918086076 1:181246537-181246559 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
918087061 1:181254761-181254783 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
918175993 1:182045693-182045715 GAGGGTACTGCAGGAGACCAGGG + Intergenic
918453231 1:184681020-184681042 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
918461755 1:184783958-184783980 GAGGGTACTGCAGGAGACCAAGG - Intergenic
918600109 1:186348311-186348333 GAGGGTTCTGCAGGAGACCAGGG - Intronic
918848048 1:189644418-189644440 GAGGGTACTGCAGGAGACCAGGG + Intergenic
918977815 1:191513315-191513337 GAGGGTACTGCAGGAGACCAGGG - Intergenic
918999637 1:191813774-191813796 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
919025593 1:192165200-192165222 GGGGGTGCTGCAGGAGACCAGGG - Intronic
919035863 1:192308439-192308461 GAGGGTACTGCAGGAGACCAGGG + Intergenic
919110069 1:193207438-193207460 GAGGGTACTGCAGGAGTCCAGGG + Intronic
919296115 1:195702638-195702660 GGGAGCGCTACGGGAGACCGGGG + Intergenic
919538133 1:198813946-198813968 GAGGGTACTGCAGGTGACCAGGG + Intergenic
920416203 1:205800690-205800712 GGGGGTGGGGCAGGAGTCCAGGG + Intronic
920788128 1:209062417-209062439 GGGGGCAGTGCAGGAGCACAGGG - Intergenic
920909005 1:210196518-210196540 AAGGGTACTGCAGGAGACCAGGG + Intergenic
921064576 1:211613602-211613624 GGTGGGGCGGCACGAGACCAGGG - Intergenic
921788159 1:219257850-219257872 GAGGGTACTGCAGGAGACCAGGG + Intergenic
921900445 1:220444632-220444654 GAAGGTACTGCAGGAGACCAGGG - Intergenic
922379350 1:225006568-225006590 GAGGGCGCTGCAGGAGACCAGGG - Intronic
922536630 1:226385885-226385907 GGGGGCGCTGCAGGAACACTTGG - Intronic
922802984 1:228372480-228372502 GGAGGAGCAGCAGGAGGCCAGGG + Exonic
922967911 1:229707307-229707329 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
923242609 1:232100073-232100095 GAGGATACTGCAGGAGACCAGGG + Intergenic
923419600 1:233799300-233799322 GGGAGCGCTACGGGAGACCAGGG + Intergenic
924120182 1:240789622-240789644 GGGAGCGCTACAGGAGACCAGGG - Intronic
924296919 1:242597095-242597117 GAGGGTACTGCAGGAGACCAGGG - Intergenic
924490027 1:244527207-244527229 GGGAGCGCTACAGGAGACTGGGG + Intronic
924728901 1:246694401-246694423 GAGGGTACTGCAGGAGACCAGGG - Intergenic
924733010 1:246729321-246729343 GAGGGTGCTGCAGGAGACCAGGG + Intronic
1062860409 10:805597-805619 GGGGGTGCTGCAGGTACCCAGGG + Intergenic
1063064247 10:2592214-2592236 GGGAGTGCGGCAGGAGACCTGGG + Intergenic
1063329113 10:5138192-5138214 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1063978741 10:11437365-11437387 TGGGCATCTGCAGGAGACCAGGG + Intergenic
1064011398 10:11739370-11739392 GAGGACGGAGCAGGAGACCAAGG - Intergenic
1064490462 10:15850557-15850579 GGGGGCGCTACAGGAGACCAGGG - Intronic
1064522990 10:16223015-16223037 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1064626175 10:17263742-17263764 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1064779062 10:18813096-18813118 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1064985669 10:21207635-21207657 GGAGCCCCTGCAGGAGATCATGG + Intergenic
1065196780 10:23274348-23274370 GAGGGCACTGCAGGAGACCAGGG + Intronic
1065475904 10:26137813-26137835 GAGGGTACTGCAGGAGACCAGGG - Intronic
1065497890 10:26348975-26348997 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1065499661 10:26367120-26367142 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1065512475 10:26492941-26492963 GGGGGCGCTGCAGGAGGCCAGGG + Intronic
1065936215 10:30522748-30522770 GGGGGCGCTGCAGGAGACTAGGG - Intergenic
1066113542 10:32219420-32219442 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1066257068 10:33690383-33690405 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1066331398 10:34427396-34427418 AGGGGCACTGCAGGAGACTAGGG - Intronic
1066621281 10:37354101-37354123 GGGGGTGCTGCAGGAGACCAGGG - Intronic
1066642262 10:37566517-37566539 GGGGGCACTACAGGAGACTAGGG - Intergenic
1066651158 10:37656304-37656326 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1066658586 10:37718318-37718340 GAGGGCACTGCAGGAGACCAAGG - Intergenic
1066686103 10:37983007-37983029 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1066788992 10:39042833-39042855 GAGGGGAATGCAGGAGACCAGGG - Intergenic
1067013988 10:42741668-42741690 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1067128213 10:43538477-43538499 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1067179163 10:43971985-43972007 GGGGCCGCTGGAGGAAGCCAAGG - Intergenic
1067528869 10:47055919-47055941 GCTGGAGCTGCAGGAGACCTTGG - Intergenic
1067600016 10:47589556-47589578 GGGGGAGCTGAAGGACACAATGG + Intergenic
1067841761 10:49686670-49686692 GAGGGTACTGCAAGAGACCAGGG - Intronic
1067943291 10:50674700-50674722 GGGGGCCCTGCGGGACACCCAGG - Intergenic
1068071757 10:52205069-52205091 GGGGGCGCTGCAGGAGATTAGGG - Intronic
1068097154 10:52505474-52505496 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1068152799 10:53155807-53155829 GAGGGCACTACAGGAGACCAAGG + Intergenic
1068423306 10:56823242-56823264 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1068568079 10:58597600-58597622 GAGGGTACTGCAGGAGACCAGGG + Intronic
1069072836 10:64007301-64007323 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
1069103995 10:64360384-64360406 GAGGGTCCTGCAGGAGACCAAGG - Intergenic
1069162218 10:65106366-65106388 GGGAGTGCTTCGGGAGACCAGGG + Intergenic
1069198423 10:65583063-65583085 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1069203886 10:65657988-65658010 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1069247858 10:66230564-66230586 GTGGGCTCTCCTGGAGACCAAGG - Intronic
1069288120 10:66742256-66742278 GGGAGCGCTATGGGAGACCAGGG - Intronic
1069570037 10:69489019-69489041 GAGGGTACTGCAGGAGACCAGGG + Intronic
1070088376 10:73258803-73258825 GGGGGCGCTACAGGAAACCGGGG - Intronic
1070463334 10:76691648-76691670 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1070482456 10:76896118-76896140 GGGGGCGCTGCAGGAGGCCAGGG + Intronic
1070497147 10:77034963-77034985 GGAGGAGCTGCAGGAAACCATGG - Intronic
1070854888 10:79599792-79599814 GGGGATGCTGCAGGAGACTAGGG - Intergenic
1070959076 10:80486325-80486347 GTGTGAGCTGCAGGAGACCAGGG + Intronic
1071189358 10:83081925-83081947 GGGGGTGCTGCAGGAGACTAGGG - Intergenic
1071380646 10:85056115-85056137 GGGAGCGCTACAGGAGACTGGGG - Intergenic
1071412487 10:85410682-85410704 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
1071493859 10:86154482-86154504 GGGGGCCCTTCTGGAGACCAGGG - Intronic
1071599733 10:86952840-86952862 GAGGGTACTGCAGGAGACCAGGG + Intronic
1071651558 10:87397437-87397459 GGGGGAGCTGAAGGACACAATGG + Intergenic
1071855507 10:89620457-89620479 GAGGGCGCTGCAGGAGACCACGG - Intronic
1072323327 10:94272164-94272186 GAAGGTACTGCAGGAGACCAGGG + Intronic
1072473164 10:95733064-95733086 GGGAGTGCTACTGGAGACCAGGG + Intronic
1072479880 10:95800537-95800559 GAGGGTACTGCAGGAGACCAGGG + Intronic
1072487955 10:95874427-95874449 GGCGGAGCTGCACAAGACCATGG - Exonic
1072498315 10:95985895-95985917 GGGAGCGCTACGGGAGACCGGGG - Intronic
1073003277 10:100301369-100301391 GGGGGCACTGCAGGTGGCCAGGG + Intronic
1073353934 10:102838674-102838696 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1073354706 10:102844583-102844605 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1073372995 10:103007432-103007454 GAGGGTACTGCAGGAGACCAGGG + Intronic
1074271365 10:111957067-111957089 GGGGGCACTGCAGGACACCAGGG - Intergenic
1075864400 10:125705140-125705162 GGGGGCGGTGGAAGAGAGCAGGG + Intergenic
1076085766 10:127629485-127629507 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1076252128 10:128993417-128993439 GGAGGCGGTGCAGGAGGGCATGG + Intergenic
1076393002 10:130117738-130117760 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1076478487 10:130768668-130768690 GGGGGCACTGCAGGAGGCCAGGG + Intergenic
1076940204 10:133600295-133600317 GGGAGTGCGGCAGGAGAACAGGG - Intergenic
1076967240 11:100436-100458 GGTGGAGCTGCCTGAGACCATGG - Intergenic
1076980578 11:202478-202500 GGGAGTGCAGCAGGAGAACAGGG - Intronic
1077017425 11:403227-403249 CGGGGCGCTGCAGAACATCACGG + Exonic
1077051147 11:567661-567683 GGGGCCGCTGCGGGAGACAGCGG - Intergenic
1077113776 11:873554-873576 GGGAGCACTGCAGGAGCCCAAGG + Intronic
1077509598 11:2950143-2950165 GTGAGGGCTGTAGGAGACCAAGG - Intronic
1077529440 11:3088270-3088292 GGGGGCTCTGCAGGAGGCCTGGG + Exonic
1077594488 11:3520018-3520040 TTGGGTACTGCAGGAGACCAGGG - Intergenic
1078036462 11:7810548-7810570 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1078232017 11:9452158-9452180 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1078385184 11:10884486-10884508 GAGGGCACTGCGGGAGACCAGGG + Intergenic
1078712886 11:13812608-13812630 GGTGGAGCTGCCGAAGACCATGG - Intergenic
1079443554 11:20539007-20539029 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1079666910 11:23117231-23117253 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1079783312 11:24637673-24637695 GAGGGCACTGCAGGAGACCAGGG - Intronic
1079829522 11:25245151-25245173 GGGAGCGCTACGGGAGACCGGGG + Intergenic
1079975852 11:27090721-27090743 GAGGGTACTTCAGGAGACCAGGG + Intronic
1080155441 11:29105601-29105623 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1080972959 11:37301229-37301251 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1080994947 11:37588277-37588299 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
1081140573 11:39493921-39493943 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1081236135 11:40649220-40649242 GAGGGTACTGCAGGAGACCAGGG + Intronic
1081328419 11:41774487-41774509 GAAGGTACTGCAGGAGACCAGGG + Intergenic
1082047887 11:47745448-47745470 GAGGGTACTTCAGGAGACCAGGG - Intronic
1082062954 11:47876016-47876038 GAGGGTACTGCGGGAGACCAGGG + Intergenic
1082115956 11:48328332-48328354 GAGGGCACTGCAGGAGACCGGGG + Intronic
1082143319 11:48634984-48635006 GAGGGTAGTGCAGGAGACCAGGG + Intergenic
1082257739 11:50051161-50051183 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1082282147 11:50281505-50281527 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1082292853 11:50400464-50400486 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1082570514 11:54732349-54732371 GAGGGTAGTGCAGGAGACCAGGG + Intergenic
1082733412 11:56827542-56827564 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1082986410 11:59173640-59173662 TTTGGCGCTCCAGGAGACCATGG - Intronic
1083099272 11:60285948-60285970 GAGGGTGCTGCAGGAGACCAGGG + Intronic
1083146072 11:60759881-60759903 GGGGGTGCGGCAGAAGAACAGGG - Intronic
1083627195 11:64077842-64077864 GGGTGGGCTTCAGGAGCCCAGGG + Intronic
1083679131 11:64343196-64343218 GGGGGTGCTGGAGGCGTCCAAGG + Exonic
1084204119 11:67581586-67581608 GGGGGTGCTGCAGGAGACTAGGG - Intergenic
1084250338 11:67893292-67893314 TTGGGTACTGCAGGAGACCAGGG - Intergenic
1084517735 11:69645556-69645578 GAGGGAGGGGCAGGAGACCAGGG + Intronic
1084578157 11:70004091-70004113 GGGGCCGCTGAAGGAGCCCCTGG - Intergenic
1084755673 11:71237146-71237168 GGGGGAGCTTCAGGATGCCATGG - Intronic
1084822450 11:71702053-71702075 TTGGGTACTGCAGGAGACCAGGG + Intergenic
1084880789 11:72170067-72170089 GGCGGAGCTGCCAGAGACCATGG + Intergenic
1085396123 11:76208011-76208033 GGGGGCGCTGGAGCAGAAAAGGG + Intronic
1085408553 11:76278228-76278250 GGGTGCACTGCAAGAGACCGGGG + Intergenic
1085463390 11:76708571-76708593 GGGGGGGCTGCTGGAGAGCCAGG + Intergenic
1085480219 11:76815843-76815865 GAGGGTACTGCAGGAGACCAAGG + Intergenic
1085941763 11:81213788-81213810 GGTGGCGCTGCCCAAGACCATGG - Intergenic
1085947159 11:81285485-81285507 GAGGGTACTTCAGGAGACCAGGG - Intergenic
1085959475 11:81443559-81443581 GGGGGTGCTGCAGGAGGCCAGGG + Intergenic
1086952487 11:92905223-92905245 GGGGTGGCTGAAGGAGATCATGG + Intergenic
1087394029 11:97573825-97573847 GAGGGCGCTGCAGGAGACCAGGG - Intergenic
1087439018 11:98159127-98159149 GAGGGTACTGCAGGAGATCAGGG + Intergenic
1087474672 11:98620769-98620791 GGCGGAGCTGCCCGAGACCATGG + Intergenic
1087681311 11:101220822-101220844 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1088087889 11:106003316-106003338 GGGGATTCTGCAGGAGACCAGGG - Intronic
1089615936 11:119694804-119694826 GGGGGGGCAGCAGGACACCTGGG - Intronic
1090676204 11:128999269-128999291 GGGGGCACCGCAGGAGACCAGGG - Intronic
1091410464 12:235921-235943 GAGGGTACTGCAGGAGACCAGGG - Intronic
1091751033 12:3021240-3021262 GGGGGACCTGGAGGAGGCCAAGG + Intronic
1092397582 12:8141847-8141869 GAGGGTACTTCAGGAGACCAGGG - Intronic
1092852267 12:12640185-12640207 GAGGGTTCTGCAGGAGACCAGGG + Intronic
1092900337 12:13053790-13053812 AGGGTACCTGCAGGAGACCAGGG + Intronic
1093347953 12:18063023-18063045 GGGAGCACTACAGAAGACCAGGG + Intergenic
1093729862 12:22555034-22555056 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1093735170 12:22612970-22612992 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1094327603 12:29256931-29256953 TGGGGCCCCACAGGAGACCACGG - Intronic
1094377115 12:29801966-29801988 GGGGGCGCTGCAGGCGGCCGGGG + Intergenic
1094385069 12:29885221-29885243 GGGGGCAGTGCAGGTGGCCAGGG + Intergenic
1094578258 12:31708361-31708383 GAGGGTACTGCAGGAGACCAGGG - Intronic
1094729023 12:33153449-33153471 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1094740377 12:33281753-33281775 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
1095252911 12:39999506-39999528 GAGGGTATTGCAGGAGACCAGGG - Intronic
1095363489 12:41373344-41373366 GGGAGCGCTACAGGAGACTGGGG + Intronic
1095585849 12:43848319-43848341 GAGGGTTCTTCAGGAGACCAGGG + Intronic
1096035819 12:48469222-48469244 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1096352592 12:50912528-50912550 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1096584434 12:52610724-52610746 GGGCGCCCTGCAGCAGGCCAAGG - Exonic
1096589306 12:52646849-52646871 GGAGGCCCTGCAGCAGGCCAAGG - Exonic
1096595509 12:52692530-52692552 GGAGGCCCTGCAGCAGTCCAAGG - Exonic
1096605395 12:52761341-52761363 GGGAGCGCTACAGGAGACCAGGG + Intergenic
1097082524 12:56443362-56443384 GAGGGCACTGCAGGAGACCAGGG - Intronic
1097110427 12:56654005-56654027 GGGGGTGCTACAGGAGACCAGGG - Intergenic
1097135768 12:56853601-56853623 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1097138874 12:56882549-56882571 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1097170943 12:57112325-57112347 GGAGGAGCTGGAGGAGACCAAGG + Intronic
1097241847 12:57581045-57581067 GGGTGCACTGAAGGAGGCCAAGG + Exonic
1097364397 12:58695506-58695528 GAGGGTACTGCAGGAGACCAGGG - Intronic
1097425577 12:59440313-59440335 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1097515754 12:60603650-60603672 GGGGGCTCTGCAGGAGACCAGGG + Intergenic
1097664399 12:62463474-62463496 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1098467828 12:70808153-70808175 GGGGGTGCTGCAGGAGAGTAGGG - Intronic
1098497177 12:71150095-71150117 GAGGGTACTGCAGGAGACCAGGG - Intronic
1098648208 12:72932080-72932102 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1098741170 12:74175268-74175290 GAGGGTTCTACAGGAGACCAGGG + Intergenic
1098747230 12:74253984-74254006 GAGGGTACTGCAGGAAACCAGGG + Intergenic
1098839142 12:75458115-75458137 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1098960558 12:76735765-76735787 GGGAGCGCTACAGGAGACTGGGG - Intergenic
1099318871 12:81119471-81119493 GAGGGTACTGCAGGAGACCAGGG + Intronic
1099580988 12:84446629-84446651 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1099724588 12:86410262-86410284 GAGGGTACTGCAGGAGACCAGGG + Intronic
1099800971 12:87455863-87455885 GAGGGTACTGCAGGAGACCATGG + Intergenic
1100087529 12:90929793-90929815 GAGGGTTCTGCAGGAGACCAGGG + Intronic
1100418027 12:94398894-94398916 GAGGGTACTGCAGGAGACCAGGG - Intronic
1100439888 12:94606973-94606995 GAGGGTACTGCAGGAGACCAAGG + Intronic
1100565683 12:95791061-95791083 GTGGGTGCTGCAGGGCACCAGGG - Intronic
1100970566 12:100065584-100065606 GAGGGTACTGCAGGAGACCAGGG - Intronic
1101024632 12:100588655-100588677 GAGGGTTCTGCAGGAGACCAGGG + Intronic
1101480850 12:105095509-105095531 GAGGGTACTGCAGGACACCAGGG + Intergenic
1101644740 12:106620749-106620771 GAGGGTACTGCAGGAGACCAGGG + Intronic
1102436319 12:112926804-112926826 GGGGGTGCTGCAGGAGACCAGGG + Intronic
1103149494 12:118624547-118624569 GGCAGCTCTGCAGGAGACCCAGG - Intergenic
1103791086 12:123471639-123471661 GGGGGAGCTGTAGCAGAACAAGG - Exonic
1104127994 12:125865448-125865470 GAGGGCACTGCAGGAGAGCAGGG + Intergenic
1104277918 12:127346926-127346948 GAGGGTACTACAGGAGACCAGGG + Intergenic
1105244407 13:18635828-18635850 GAGGGTATTGCAGGAGACCAGGG - Intergenic
1105305240 13:19163966-19163988 GGGGGCGCTACAGGAGACTGGGG + Intergenic
1105804137 13:23939902-23939924 GAGGACACTGCAGGAGAACAGGG + Intergenic
1105897767 13:24731695-24731717 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1106754738 13:32811253-32811275 GGGGGACCTGCAGGGGACCCTGG - Intergenic
1106961060 13:34998454-34998476 GGGAGTGCTGCAGGAGACGGGGG + Intronic
1107239230 13:38212016-38212038 GAGGGTATTGCAGGAGACCAGGG + Intergenic
1107817420 13:44256482-44256504 GGGGACCCAGCAGGAGAACAGGG - Intergenic
1108218322 13:48207379-48207401 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1108633502 13:52310045-52310067 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1108653185 13:52502492-52502514 GAGGGCACTGCAGAAGACCAGGG - Intergenic
1108791480 13:53973522-53973544 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1108799028 13:54070132-54070154 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1108902182 13:55425175-55425197 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1108916822 13:55624102-55624124 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1108960529 13:56222092-56222114 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1109159095 13:58949846-58949868 GGGGGCGCTGTAGGAGACCAGGG - Intergenic
1109169225 13:59075428-59075450 GGTGGAGCTGCACAAGACCATGG - Intergenic
1109377710 13:61519379-61519401 GGGGGCGCTGCAGGAGACTAGGG + Intergenic
1109514723 13:63427341-63427363 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1109590620 13:64476145-64476167 GAGGGTTCTGCAGGAGGCCAGGG - Intergenic
1109644597 13:65237030-65237052 GCGGGCACTGCAGGAGACCAGGG - Intergenic
1109647175 13:65273991-65274013 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1109682551 13:65771939-65771961 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1109755966 13:66760880-66760902 GGGGGTGCTGAAGGAGACCAGGG - Intronic
1109911890 13:68923302-68923324 GGGGGCGCTGCAGGAGACTAGGG + Intergenic
1109918109 13:69018386-69018408 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1109963365 13:69660391-69660413 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1110080127 13:71299006-71299028 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1110408990 13:75183786-75183808 TGAGGTACTGCAGGAGACCAGGG - Intergenic
1110456962 13:75699868-75699890 GGGGGCGCTGCAGGAGACCAGGG + Intronic
1110464020 13:75780265-75780287 GGGGGTGCTGCAGGAGACCAGGG + Intronic
1110529105 13:76575856-76575878 GAGGGTACTGCAGGAGACCGGGG - Intergenic
1110541708 13:76713564-76713586 GGGCTCACTGCAGGAGAGCATGG + Intergenic
1110579969 13:77110327-77110349 GAGGGTACTGCAGGAGACCAGGG - Intronic
1110660730 13:78057070-78057092 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1110953666 13:81525132-81525154 GAGGGTACTGCAAGAGACCAGGG - Intergenic
1111011236 13:82317629-82317651 GAGGGTACTGCAGGACACCAGGG + Intergenic
1111452299 13:88435172-88435194 GAGGGTACTGCAGGAGACAAGGG - Intergenic
1111468298 13:88645273-88645295 GGGAGCACTACGGGAGACCAGGG + Intergenic
1112053628 13:95670051-95670073 CAGGGTACTGCAGGAGACCAGGG + Intergenic
1112093547 13:96108252-96108274 GGGGGCGCTACAGGAGACTAGGG - Intronic
1112252348 13:97793659-97793681 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1113214055 13:108017531-108017553 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1113536603 13:111071615-111071637 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1114394458 14:22344384-22344406 AGGGGCGCTGCAGGAGACCAGGG + Intergenic
1114750538 14:25199891-25199913 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1115085174 14:29506848-29506870 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1115280214 14:31653313-31653335 GAGAGTACTGCAGGAGACCAGGG + Intronic
1115386554 14:32804708-32804730 GAGGGTACTGTAGGAGACCAGGG + Intronic
1115651267 14:35404266-35404288 CGGGGCGGTGCAGGAGCCCCGGG + Intronic
1115810924 14:37106443-37106465 GAGGGTACTGCAGGAGACCAGGG - Intronic
1115886795 14:37981298-37981320 GAGGGTTCTGCAAGAGACCAGGG - Intronic
1115958792 14:38811162-38811184 GGGAGTGCTACAGGAGACCGGGG + Intergenic
1116470645 14:45281968-45281990 GGGGGCGCCACAGGAGACCAGGG - Intergenic
1116554721 14:46288411-46288433 GAGGGTACTGTAGGAGACCAGGG + Intergenic
1116582473 14:46659807-46659829 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1116725913 14:48561555-48561577 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1116886988 14:50231479-50231501 GCGGGCGCTGCGGGAGGCGAGGG - Exonic
1117098615 14:52322623-52322645 GAGGGTACTGCAGGAGACCAGGG + Intronic
1117276411 14:54198536-54198558 GGGAGTGCTACGGGAGACCAGGG - Intergenic
1118216353 14:63812105-63812127 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1118372198 14:65146791-65146813 GGGAGCGCTACAGGAGACTGGGG + Intergenic
1119007799 14:70947966-70947988 GGGGGCGCTGCTGGAGACCAGGG - Intronic
1119101881 14:71887597-71887619 GAAGGTACTGCAGGAGACCAGGG - Intergenic
1119299808 14:73562729-73562751 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
1119573251 14:75695244-75695266 GGGAGCGCGACGGGAGACCAGGG - Intronic
1119695924 14:76713455-76713477 GGGGGCAGTGCAGGAGAGGAGGG - Intergenic
1119869266 14:78001451-78001473 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1120109703 14:80539905-80539927 GAGGGTACTGCAGGAGACCAGGG - Intronic
1120130360 14:80799719-80799741 GAGGGTACTGCAGGAGACCAGGG - Intronic
1120201024 14:81538342-81538364 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1120295390 14:82633870-82633892 GGGGGCGCTGCAGAGGGCCAGGG - Intergenic
1120397095 14:83981891-83981913 GAGGGTTCTGCAGGAGACCAAGG - Intergenic
1120637132 14:86966454-86966476 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1121064912 14:90953746-90953768 GAGGGTACTGCAGGAGACCAGGG - Intronic
1121417130 14:93787529-93787551 GGGGTGGCTGCAAGAGGCCAGGG + Intronic
1121541877 14:94733857-94733879 GGGTGAGCTGCAGGAGAGCTGGG - Intergenic
1122319440 14:100845046-100845068 GCTGGCCCTGGAGGAGACCAGGG - Intergenic
1122529828 14:102417908-102417930 GAGGCTGCTGCAGGAGTCCAGGG + Intronic
1122558222 14:102592765-102592787 GCGGGCGCGGCGGGAGCCCACGG - Exonic
1122645830 14:103193121-103193143 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1122844258 14:104482227-104482249 GAGGGTACTGCAGGAGACCAGGG + Intronic
1123098642 14:105778739-105778761 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1123119922 14:105911759-105911781 GGGTTCACTGCAGGTGACCAGGG - Intergenic
1202845496 14_GL000009v2_random:169382-169404 AGGGGCCCTCCAGGAGACCTAGG - Intergenic
1202914894 14_GL000194v1_random:159652-159674 AGGGGCCCTCCAGGAGACCTAGG - Intergenic
1202889790 14_KI270722v1_random:145178-145200 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1123402656 15:20003326-20003348 GGGTTCACTGCAGGTGACCAGGG - Intergenic
1123495294 15:20817277-20817299 GGGACAGCAGCAGGAGACCAGGG - Intergenic
1123511995 15:21009980-21010002 GGGTTCACTGCAGGTGACCAGGG - Intergenic
1123551783 15:21386370-21386392 GGGACAGCAGCAGGAGACCAGGG - Intergenic
1123931585 15:25174307-25174329 AGGAGCGCTTCGGGAGACCAGGG + Intergenic
1124095250 15:26643222-26643244 CGGGGCAGTGCAGGAGACCAGGG - Intronic
1124225776 15:27893654-27893676 GAGGGTTCTGCAAGAGACCAGGG - Intronic
1124248203 15:28088945-28088967 GGGAGCACTACGGGAGACCAGGG + Intronic
1124253544 15:28122778-28122800 GCTGGGGCTGCAGGAGAGCAGGG - Intronic
1124323763 15:28738340-28738362 GGGATCGCTGCGGGAAACCAGGG + Intronic
1124527655 15:30471581-30471603 GGGATCGCTGCGGGAAACCAGGG + Intergenic
1124613263 15:31223616-31223638 GGGGGTGCTGCAGGCGTCCTGGG + Intergenic
1124771004 15:32536121-32536143 GGGATCGCTGCGGGAAACCAGGG - Intergenic
1125005054 15:34807521-34807543 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1126059941 15:44770958-44770980 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1126267173 15:46768467-46768489 GAGGGCGCTGCAAGAGACCAGGG - Intergenic
1127092361 15:55479800-55479822 GAGGGTTCTGCAGGAGACCAGGG - Intronic
1127397031 15:58551173-58551195 GGAGGGGCTGCAGGAGAACTGGG - Intronic
1127579477 15:60324334-60324356 GTGGGGGCTGCTGGAGAGCAGGG - Intergenic
1127843529 15:62849883-62849905 GGGGGAACTGCAGGAGTTCATGG + Intergenic
1128460499 15:67863388-67863410 GGGGGCGCAGCCGGAGTCCCAGG + Intergenic
1128535091 15:68484689-68484711 GGGGAGGCTGGGGGAGACCAGGG + Intergenic
1128598804 15:68977563-68977585 GGGAGCGCTACTGGAGACCGGGG + Intronic
1129043236 15:72708815-72708837 GAGGGTACTGCAGGAGACCAGGG - Intronic
1129252189 15:74315143-74315165 GAGGCCGTTGCAGGGGACCAGGG + Intronic
1129760785 15:78128282-78128304 GGGAGAGCAGCAGGAGAACAAGG + Intronic
1130583958 15:85164958-85164980 GAGGGCACTCCAGGAGACCAGGG - Intergenic
1130728456 15:86465665-86465687 TGGGGGTGTGCAGGAGACCAGGG - Intronic
1131000325 15:88934605-88934627 GGGGGCGCTACAAGAGACGGGGG + Intergenic
1131373406 15:91903505-91903527 GGGGGAGCTGTGGGAGAGCAGGG + Intronic
1131387235 15:92017816-92017838 GGGGTTGCTCCAGCAGACCAGGG + Intronic
1131589691 15:93735206-93735228 GGGAGTGCTACAGGAGATCAGGG - Intergenic
1132058050 15:98667489-98667511 GGACGCGCTGCTAGAGACCATGG + Intronic
1132440935 15:101863399-101863421 GGTGGAGCTGCCTGAGACCATGG + Intergenic
1202960128 15_KI270727v1_random:113612-113634 GGGACAGCAGCAGGAGACCAGGG - Intergenic
1132508561 16:325073-325095 GGGCGCGCCCCAGGAAACCATGG + Intronic
1132802357 16:1760698-1760720 GGAGGCTCAGGAGGAGACCACGG - Intronic
1132867354 16:2100087-2100109 GGCCGCACTGCAGGAGGCCACGG + Intronic
1132904980 16:2277903-2277925 GGAGGCGCTGGAGGAGTTCAAGG - Exonic
1132911761 16:2317365-2317387 GGGGTCGCTGCGGGACAGCACGG + Exonic
1133065778 16:3206175-3206197 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1133118165 16:3589959-3589981 GGGGGCGCTGCCGGAGAATCGGG - Exonic
1133324877 16:4936554-4936576 GGGGTCGCTGCGGGCGACCCAGG - Intronic
1133359365 16:5161860-5161882 TTGGGTACTGCAGGAGACCAGGG - Intergenic
1133983355 16:10650024-10650046 GGGGGAGTGGGAGGAGACCAGGG - Intronic
1134093061 16:11401862-11401884 GGGGGGGCAGCAGGAGACCTGGG - Intronic
1134191056 16:12121493-12121515 GGTGGTGCAGCAGGAGACGAAGG + Intronic
1134524423 16:14933028-14933050 GGCCGCACTGCAGGAGGCCACGG - Intronic
1134548478 16:15127913-15127935 GGCCGCACTGCAGGAGGCCACGG + Intronic
1134584141 16:15396292-15396314 GAGGGCGCTGCAGGAGCCTGGGG + Intronic
1134712011 16:16331515-16331537 GGCCGCACTGCAGGAGGCCACGG - Intergenic
1134719868 16:16374808-16374830 GGCCGCACTGCAGGAGGCCACGG - Intergenic
1134947558 16:18337077-18337099 GGCCGCACTGCAGGAGGCCACGG + Intergenic
1134954817 16:18377179-18377201 GGCCGCACTGCAGGAGGCCACGG + Intergenic
1135093680 16:19543772-19543794 GAGGGTACTGCAGGAGACCAGGG - Intronic
1135202830 16:20453844-20453866 GAGGGTACTGCAGGACACCAGGG - Intronic
1135216267 16:20574022-20574044 GAGGGTACTGCAGGACACCAGGG + Intronic
1135593489 16:23722849-23722871 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1136192149 16:28623024-28623046 GAGGGCGCTGCAGGAGCCTGGGG - Intronic
1136490261 16:30603418-30603440 GGGGGAGCTGCATGGTACCAGGG - Exonic
1136998140 16:35205344-35205366 GGGAGTGCAGCAGGAGAACAGGG - Intergenic
1137285283 16:47010588-47010610 GGGGAGGCTGCAGGAGTTCAGGG + Intergenic
1137335043 16:47540199-47540221 GAGGGTACTGCAGGAGACCAGGG - Intronic
1137556422 16:49473206-49473228 TCGGCCTCTGCAGGAGACCAGGG + Intergenic
1138011457 16:53384767-53384789 GAGGGCGCTGCAGGAGACCAGGG - Intergenic
1138500504 16:57440163-57440185 GGGAGTGCTACGGGAGACCAGGG - Intronic
1138637519 16:58352839-58352861 GGGAGCGCTACCGGAGACCGGGG + Intronic
1139014135 16:62669370-62669392 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1139016047 16:62690207-62690229 GAGCGTGTTGCAGGAGACCAGGG - Intergenic
1139268099 16:65658353-65658375 GGGGGTGCTGCAGGAGGACTGGG + Intergenic
1139369700 16:66459192-66459214 GGGTTCGGGGCAGGAGACCAGGG - Intronic
1140060155 16:71562056-71562078 GAGGGTACTGCAGGAGACCAGGG + Intronic
1140573667 16:76138311-76138333 GAGGGTACTTCAGGAGACCAGGG + Intergenic
1140589751 16:76337691-76337713 GAGGGTACTGCAGGAGACCAGGG + Intronic
1141068349 16:80932088-80932110 GGGGAGGCTGCAGGAGACTGGGG + Intergenic
1141427611 16:83953888-83953910 TGGGGAGCTGCAGGAGACCCTGG + Intronic
1141462116 16:84183754-84183776 TGGGGCACTGCATGTGACCAAGG - Exonic
1141478697 16:84292017-84292039 GAGGGCGCTGCAGGGGCACAGGG + Intergenic
1141685447 16:85567220-85567242 GGTGGGTCTGCAGGGGACCAGGG + Intergenic
1142163133 16:88569808-88569830 GAGGGCCCGGCCGGAGACCAGGG - Intergenic
1143408865 17:6696565-6696587 GGAGGCCCTGCAGGACACCCTGG - Intronic
1143483341 17:7239264-7239286 GGGGGCGATGCTGGAAGCCATGG - Exonic
1143936098 17:10485411-10485433 GGGGGTGCTGCAGGAGACTAGGG + Intergenic
1145370802 17:22304746-22304768 AGGGGGTCTGCAGGAGACCCAGG - Intergenic
1145387536 17:22426775-22426797 GGGAGTGCTACAGGAGACCGGGG + Intergenic
1145801232 17:27686538-27686560 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1145819661 17:27822260-27822282 GGGAGCGCTACGGGAGACCGGGG + Intronic
1146803359 17:35844884-35844906 GGGGGCTATGGAGGAGACCGTGG + Exonic
1146850254 17:36215590-36215612 GGGAAGGCTGCAGGAGGCCAGGG + Intronic
1147170827 17:38617759-38617781 GTGGGCCCTGCAGGTGCCCACGG + Intergenic
1147591385 17:41685939-41685961 GGGAGCGCTACAGGAGACCGGGG - Intergenic
1147672421 17:42184300-42184322 GGAGGCGCTGCAGCCGACCCTGG + Exonic
1148622735 17:49046398-49046420 GGGAGGGCTGCAGGAGCCCAGGG + Intronic
1148645256 17:49216545-49216567 GAAGGCGCTGGAGGAGACCATGG + Exonic
1148777967 17:50106108-50106130 GGGGGCGGTGCTGGGGCCCAGGG + Intronic
1148911383 17:50944815-50944837 GGGGCCGCCGCAGGAGCGCAGGG - Intergenic
1149174991 17:53858962-53858984 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1149182472 17:53955913-53955935 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1149196416 17:54127065-54127087 GAGGGTACTGCAGGAGAACAGGG - Intergenic
1149207491 17:54265087-54265109 GAGGGTACTGCAAGAGACCAGGG + Intergenic
1149857219 17:60093241-60093263 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1150131556 17:62671973-62671995 GGGGGTGCAGCAGGAGAGGAGGG - Intronic
1150295256 17:64003958-64003980 GGAGGCTCTGCAGGGGACAAAGG + Exonic
1151246583 17:72799642-72799664 GAGGGTACTGCAGGAGACCAGGG - Intronic
1151367207 17:73625391-73625413 GAGGGGGCAGCAGGAGAACAGGG + Intronic
1151560455 17:74866870-74866892 GGGGGTGCTGCTGGGGAACAGGG + Exonic
1151702500 17:75750831-75750853 GTGGGTGCGGCAGGACACCAGGG - Exonic
1151714373 17:75823872-75823894 GGGGACCCAGCAGGAGACCTGGG - Intronic
1151873409 17:76851704-76851726 GTGGGGGCTGCTGGAGACCCAGG - Intergenic
1152139261 17:78526675-78526697 GGGGTCGCTGAAGGAGAACGGGG + Exonic
1152415225 17:80155723-80155745 GAGGGCACTACAGGAGACCAAGG - Intergenic
1152504731 17:80741326-80741348 GAGGGCAGTGCAGGAGGCCATGG + Intronic
1152923980 17:83079404-83079426 GGGGGCGCTGCAGGAGGAGGGGG - Intergenic
1152995744 18:405062-405084 GAGGGTACTGCAGGAGACCAGGG - Intronic
1153074227 18:1144270-1144292 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1153237638 18:3004041-3004063 GAGGGTACTGTAGGAGACCAGGG - Intronic
1153323278 18:3793689-3793711 GGAGGCCATGCAGGAGAGCAGGG - Intronic
1153764293 18:8360655-8360677 AGACGCACTGCAGGAGACCAGGG + Intronic
1153889886 18:9503092-9503114 GAGTGTACTGCAGGAGACCAGGG - Intronic
1154081765 18:11264275-11264297 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1154089301 18:11342647-11342669 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1154444530 18:14424074-14424096 GAGGGTATTGCAGGAGACCAGGG + Intergenic
1155323471 18:24642617-24642639 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1156019063 18:32579248-32579270 GAGGGCACTTCAGGAGACCAGGG - Intergenic
1156173656 18:34516513-34516535 GGGGACTCTACAGGAGACCCGGG + Intronic
1156993568 18:43439553-43439575 GAGGGTGCTGCAGGAGACCAGGG - Intergenic
1157643768 18:49245526-49245548 GAGGGTACTGCAGGAAACCAGGG - Intronic
1157706193 18:49808937-49808959 GAGGGTACTGCAGGAGACCAGGG + Intronic
1157756293 18:50220666-50220688 GAGGGTTCTGCAGAAGACCAGGG + Intergenic
1157756599 18:50223262-50223284 GAGGGTTCTGCAGAAGACCAGGG + Intergenic
1157758636 18:50241921-50241943 GAGGGTACTGCAGGAGACCAGGG + Intronic
1158563262 18:58533063-58533085 GAGGGCCCTGCCGGAGACTACGG - Intronic
1159260447 18:66006035-66006057 TCGGGCCCTGCAGGAGCCCACGG + Intergenic
1159347715 18:67228297-67228319 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1159549446 18:69879287-69879309 GGGGGTGCTGCAGGAGGCCAGGG + Intronic
1159815710 18:73071828-73071850 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1159896048 18:73996871-73996893 GGTGGAGCTGCTGAAGACCATGG + Intergenic
1160119282 18:76113164-76113186 TGGGGTGCTGCAGGAGAACGGGG + Intergenic
1160249232 18:77186477-77186499 GGGGGCGCTGCAGGAGACTAGGG + Intergenic
1160288415 18:77568321-77568343 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1160620192 18:80165146-80165168 GAAGGTTCTGCAGGAGACCAGGG + Intronic
1160644043 19:170059-170081 GGTGGAGCTGCCTGAGACCATGG - Intergenic
1160737261 19:669146-669168 GAGGGTACTGCAGGAGATCAGGG - Intergenic
1160740852 19:685265-685287 GTGGGGGCTGCTGGACACCAGGG - Intergenic
1160928050 19:1556313-1556335 GGGGGCGCTGGGGGCGCCCAGGG + Exonic
1160983651 19:1827774-1827796 GGGCGGCCTGCGGGAGACCAAGG - Exonic
1161233489 19:3186985-3187007 GGGGACGTGGGAGGAGACCAGGG - Intronic
1161545424 19:4877745-4877767 GGGCTCGCTGCAGGAAGCCAGGG + Intergenic
1161605147 19:5210756-5210778 GGGGCCGCTGGCGGAGACCACGG - Exonic
1162684130 19:12367537-12367559 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1162798238 19:13097643-13097665 GGGGGCGCGGCAGGGGTCCCCGG + Intronic
1162949259 19:14061143-14061165 GGGGGTGGTACAGGAGACCACGG - Intergenic
1163057414 19:14731062-14731084 AGGGGCGGTGCTTGAGACCAGGG - Intronic
1163235699 19:16029216-16029238 GGGGGCGATGGGGGGGACCAGGG + Intergenic
1163393329 19:17043987-17044009 GAGGTCTCGGCAGGAGACCAGGG + Intergenic
1163612212 19:18307570-18307592 GAGGGCGCTGCAGCAGAGCCAGG + Intronic
1163881885 19:19930866-19930888 GGTGCCGAGGCAGGAGACCAAGG - Intronic
1163941651 19:20500661-20500683 GAGGGTACTGCGGGAGACCAGGG + Intergenic
1164091906 19:21961584-21961606 GAGGGTACTGCAGGAGACCAGGG + Intronic
1164237361 19:23348968-23348990 GAAGACACTGCAGGAGACCAGGG - Intronic
1164268802 19:23649871-23649893 GAGGGTTCTGCAGGAGACCATGG - Intronic
1164288701 19:23847722-23847744 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1164289820 19:23857019-23857041 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1164314597 19:24075774-24075796 GGGGGCGCTGCAGGAGACCAGGG + Intronic
1164326441 19:24196664-24196686 GAGGGTACTGCAGGAGACCGGGG + Intergenic
1164339314 19:24371992-24372014 GGGAGGGCTGCAGGAGACGGGGG - Intergenic
1164405789 19:27944840-27944862 GAGCGTTCTGCAGGAGACCAGGG - Intergenic
1164760166 19:30722670-30722692 GGGGTGGCTGCAGCAGACCCTGG - Intergenic
1164847363 19:31445044-31445066 AGGGGCGCTGCAGGAACTCACGG - Intergenic
1165225053 19:34348968-34348990 GGTGGGGCTGCAGGAGGCCCTGG + Intronic
1165300542 19:34965640-34965662 GGGGGCGCTGCAGGAGACTAGGG - Intergenic
1165851530 19:38852447-38852469 GGGGACACGGCAGGAGACCGAGG + Intergenic
1166156838 19:40919769-40919791 GAGGGTTCTGCAGGAGACCAAGG - Intergenic
1166207254 19:41279150-41279172 CTGGGTGCTGCAGGAGTCCAGGG - Exonic
1166236797 19:41462699-41462721 GAGGGCACTGCAGGGGACCAGGG + Intergenic
1166426874 19:42686805-42686827 GAGGGTACTGCAGGAGACTAGGG + Intronic
1167465024 19:49646135-49646157 GGCGGCGCTGCCGGAGTCCACGG + Exonic
1168061616 19:53896082-53896104 ATGGGCTCTGCAGGAGACAAGGG + Intronic
1168295169 19:55374607-55374629 GGGGGCTCTGCAGGGGGCCGGGG - Intergenic
1168712174 19:58507828-58507850 GAGGGTACTGCAGGAGACCAGGG - Intronic
1202665194 1_KI270708v1_random:112000-112022 GAGGGTACTGCAGGAGACCAGGG + Intergenic
925009407 2:470941-470963 TTGGGAGCTGCAGGAGAGCAGGG - Intergenic
925112914 2:1351894-1351916 GGAGGGGCTGCAAGAGTCCAGGG - Intronic
925350675 2:3198975-3198997 GGGGGCACTGCAGGAGGCCAGGG + Intronic
925393444 2:3515359-3515381 GAGGGTACTGCAGAAGACCAGGG - Intronic
925456097 2:4017826-4017848 GAGGGCACTGCAGGATACCAGGG + Intergenic
925660618 2:6198591-6198613 GAGGGTACTACAGGAGACCAGGG - Intergenic
925845319 2:8028567-8028589 GGAGGCGGTAGAGGAGACCATGG - Intergenic
925845410 2:8028985-8029007 GGGGGTGCTGGAGCAGCCCATGG + Intergenic
926062816 2:9814592-9814614 GTAGGCGCTACGGGAGACCAGGG + Intergenic
926231232 2:11005626-11005648 TGTGGAGCTGGAGGAGACCAAGG + Intergenic
926320398 2:11745298-11745320 GGTGGCACTGCAGGAAACCGGGG - Intronic
926528303 2:14010107-14010129 GAGGGCACTGCAGGAGACCAGGG + Intergenic
926586509 2:14691629-14691651 GAGGGTACTGCAGGAGACCAGGG + Intergenic
926643078 2:15258593-15258615 AAGGGTACTGCAGGAGACCAGGG - Intronic
926717840 2:15939171-15939193 GGGGGCTGTCCAGGAGATCAGGG + Intergenic
927099571 2:19777585-19777607 TGGGAAGCTGCAGGAGTCCAAGG - Intergenic
927148759 2:20183946-20183968 GTGGGTGCAGCAGGAGACCCAGG - Intergenic
927149171 2:20185952-20185974 GCGGGTGCTGCAGGGGAACAGGG + Intergenic
928491040 2:31783697-31783719 GAGGGCACTGCAGGAGACCAGGG - Intergenic
928729144 2:34210542-34210564 CGGGGAGCTGCAGGAGACCACGG + Intergenic
928897203 2:36279673-36279695 GGGAGCGCTGTAGGAGGCCAGGG - Intergenic
928901571 2:36323799-36323821 GGGAGCGCTACAGGAGACCAGGG - Intergenic
929254069 2:39790565-39790587 GAGGGCGCTGCAGGAGACCAGGG + Intergenic
929350208 2:40941790-40941812 GAGGGTACTGCAGGAGATCAGGG - Intergenic
929594188 2:43165808-43165830 GGGGGCGGTGGAGAAAACCAAGG + Intergenic
929976801 2:46643014-46643036 GAGGGCACTGCAGGAGACCAGGG + Intergenic
930300663 2:49611789-49611811 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
930423179 2:51178961-51178983 GAGGGTACTGCAGGAGAACAGGG - Intergenic
930781912 2:55231953-55231975 GGAGGCGCTACAGGAGAGAAAGG + Intronic
931578500 2:63746666-63746688 TGGGGCGCTGCAGGAGACTAGGG - Intronic
931599431 2:63989076-63989098 GGGGGTGCTGCAGGAGACTAGGG - Intronic
931600365 2:63996759-63996781 GGGGGTGCTGCAGGAGACTAGGG - Intronic
932071955 2:68629314-68629336 GAGGGTACTGCAGGAGACCAGGG + Intronic
932139138 2:69260243-69260265 GAGGGTACTGCAGGAGACCAGGG - Intergenic
932395570 2:71445087-71445109 GAGGGTACTGCAGGAGACCAGGG - Intergenic
932484323 2:72073525-72073547 GAGGGTACTGCAGGAGACCAGGG + Intergenic
932620902 2:73264513-73264535 GGGCGGGCTGCAGAATACCAGGG + Exonic
932777288 2:74535875-74535897 GTGGGAGCTGCAGGAGGGCAGGG + Intronic
933015182 2:77115014-77115036 GAGGGTACTGCAGGAGACCAGGG + Intronic
933401912 2:81809190-81809212 GAGGGTACTGAAGGAGACCAGGG + Intergenic
933459955 2:82569991-82570013 GGGAGCTCTGCAGGAGACTGGGG - Intergenic
933598554 2:84306539-84306561 GGGGGCGCTGCAGGAGGCCAGGG + Intergenic
934929983 2:98414357-98414379 GGGGGTGCTGCAGGAGGCCAGGG - Intergenic
934932210 2:98435855-98435877 GGGCATGCTGCAGGAGACTAGGG - Intergenic
935018319 2:99205672-99205694 GGGGGTGCTGCAGGAGGCCAGGG - Intronic
935481146 2:103591954-103591976 GAGGGTACTACAGGAGACCAAGG - Intergenic
935681172 2:105638472-105638494 GGGGCCCCTCCAGGAGACCTAGG + Intergenic
935762126 2:106330781-106330803 GAGGGTACTGCAGGAGATCAGGG + Intergenic
935824180 2:106926986-106927008 GAGGCTTCTGCAGGAGACCAGGG + Intergenic
936694430 2:114929382-114929404 GAGGGCATTGCAGCAGACCAGGG + Intronic
937069886 2:119055019-119055041 GAGGGTACTGCAGGAGACCAGGG + Intergenic
937112098 2:119374276-119374298 GAGGGTACTGCAGGAGACCAGGG + Intergenic
937163761 2:119793127-119793149 GGGGACGCTGCAGGAGACCAGGG + Intronic
937591529 2:123618782-123618804 GAGGGTACTGCAGAAGACCAGGG + Intergenic
937606365 2:123806243-123806265 GAGTGTACTGCAGGAGACCAGGG + Intergenic
937613318 2:123890375-123890397 GAGGGCGCTACAGGAGACTGGGG - Intergenic
937794673 2:126002866-126002888 GGGAGCGCTATGGGAGACCAGGG - Intergenic
937798358 2:126052135-126052157 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
937838364 2:126497293-126497315 GAGTGTACTGCAGGAGACCAGGG + Intergenic
937975856 2:127581750-127581772 GTGGGCGCTGCCCGAGGCCAGGG - Intronic
938308733 2:130271156-130271178 GGGAGCGCTACAGGAGACTGGGG + Intergenic
938507495 2:131901699-131901721 GAGGGTACTGCAGGAGACCAGGG + Intergenic
938616524 2:133004778-133004800 GAGGGCACTGCAGGAGACCAGGG + Intronic
938634337 2:133206899-133206921 GAGCGTACTGCAGGAGACCAGGG - Intronic
938842614 2:135177595-135177617 GAGGGTACTGCAGGAGACCAGGG + Intronic
938858562 2:135341806-135341828 GGGGGCGCTGCAGGAGACCAGGG - Intronic
939133161 2:138262252-138262274 GAGGGTACTGCAGGAGACCAGGG - Intergenic
939146899 2:138426289-138426311 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
939306174 2:140415074-140415096 GAGGGTACTGCAGGAGACCAAGG - Intronic
939476626 2:142695306-142695328 GGGGGTGCAGCAGGAGAACAGGG + Intergenic
939649951 2:144747769-144747791 GGGAGCCCTACGGGAGACCAGGG - Intergenic
939822083 2:146969868-146969890 GAGGATACTGCAGGAGACCAGGG + Intergenic
939826604 2:147023193-147023215 GAGGATACTGCAGGAGACCAAGG + Intergenic
940006022 2:149010224-149010246 GAGCGCGCTGAAGGAGGCCAAGG + Exonic
940156514 2:150662326-150662348 GGGAGTGCTACAGGAGACCCGGG + Intergenic
940299658 2:152163816-152163838 GAGGGTACTGCAGGAGACCAGGG - Intronic
940436625 2:153664169-153664191 GAGGGCACTGCAGGAGACCAGGG + Intergenic
940639022 2:156329165-156329187 AGCTGCCCTGCAGGAGACCATGG - Intronic
941074010 2:160987025-160987047 GAGGGTACTGCAGGAGACCAGGG + Intergenic
941424006 2:165320266-165320288 GGTGGAGCTGCTGAAGACCAAGG - Intronic
942094669 2:172525797-172525819 GAGGGCACTGCGGGAGACCAGGG - Intergenic
942108683 2:172658755-172658777 GAGGGTACTGCAGGAGACCAGGG - Intergenic
942312870 2:174671715-174671737 GGGAGCGCTACGGGAGACCGGGG - Intronic
942408200 2:175678009-175678031 GGCGCAGCTGCAGGAGTCCAGGG - Intergenic
942802213 2:179888882-179888904 GAGGGTACTGCAGGAGACCAGGG - Intergenic
942997175 2:182276892-182276914 GAGGGTACTGCAGGAGACCAGGG - Intronic
943171535 2:184407226-184407248 GAGGGTACAGCAGGAGACCAGGG - Intergenic
943213993 2:185006751-185006773 GTGGGCACTGCAGGAGACCTGGG + Intergenic
943273310 2:185836069-185836091 GAGGGTACTGCAGGAGACCAGGG - Intergenic
943502673 2:188711643-188711665 GGGAGCGCTACGGGAGACCAGGG - Intergenic
943750792 2:191507496-191507518 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
943846861 2:192660755-192660777 GAGGGCACTGCAGGAGAAGAGGG + Intergenic
943872994 2:193025801-193025823 GAGGGCACTGCAGGAGACCAGGG - Intergenic
943943026 2:194023105-194023127 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
944151272 2:196561253-196561275 GGCGGCACTGCAGGAGGCCAGGG - Intronic
944174810 2:196817648-196817670 GAGAGTACTGCAGGAGACCAGGG + Intergenic
944395613 2:199263054-199263076 GAGGGTACTGCAGGAGACCAGGG - Intergenic
944753316 2:202733426-202733448 GAGGGTACTACAGGAGACCAGGG + Intronic
944760719 2:202810856-202810878 GGGAGCGCTACAGGAGACCAGGG - Intronic
945357208 2:208854908-208854930 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
945371098 2:209018817-209018839 AGAGGTGCTGCAGGAGACTAGGG - Intergenic
945472854 2:210247078-210247100 GAGGGCACTGCAGGAGACCAGGG + Intergenic
945488324 2:210424915-210424937 GGGAGTGCTTCGGGAGACCAGGG + Intergenic
945723661 2:213449155-213449177 GAGGGTTCTGCAGGAGACCAGGG - Intronic
946125797 2:217561623-217561645 GAGGGTACTGCAGGAGACCAGGG - Intronic
946368528 2:219266162-219266184 GGGGGCGGTGCTGGAGCTCAGGG + Intronic
946393996 2:219434407-219434429 GGAGGCGCTGGGGGAGGCCATGG + Intergenic
947008387 2:225538053-225538075 AGGGGAGCTGCCTGAGACCATGG - Intronic
947071356 2:226291489-226291511 GAGGGTACTGCAGGAGACCAGGG - Intergenic
947800743 2:232927653-232927675 GAGGGCGCTGGAGGAGACTCCGG + Intronic
948339869 2:237241051-237241073 GAGGGTACTGCAGGAAACCAGGG - Intergenic
948814044 2:240500644-240500666 GTGGGGACTGCAGGTGACCATGG - Intronic
948903591 2:240967744-240967766 GTGGGAACTGCAGGAGGCCAGGG - Intronic
948986220 2:241526037-241526059 GAGGGTACTGCAGGAGACCAGGG - Intergenic
949042317 2:241855100-241855122 GGGGGCGGAACAGGAGCCCAGGG - Intronic
949047434 2:241878157-241878179 GGGGGCGCCGCAGGACAGCGCGG - Intergenic
1170499569 20:16960938-16960960 GGGGGTGCTGCTCAAGACCATGG - Intergenic
1170506132 20:17027555-17027577 GGGAGCACTACAGGAGACCAGGG - Intergenic
1171175959 20:23050757-23050779 GGGGGGGCTGGAGGAGGACATGG + Intergenic
1171544705 20:25991171-25991193 AGGGGGCCTGCAGGAGACCCAGG - Intergenic
1172188299 20:33045532-33045554 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
1172470373 20:35189340-35189362 GGGGACGCTGCAGGAGACCAGGG - Intergenic
1172599022 20:36170900-36170922 GCGGGCTCTGCTGGAGACCCAGG + Intronic
1172705915 20:36881741-36881763 GGGGGCACTGGGGGACACCAAGG + Intronic
1173755263 20:45510229-45510251 GGGGGAGTTTCAGGAAACCAAGG - Intergenic
1174066292 20:47868071-47868093 GGAGGCCCCGCAGGAGAGCAGGG + Intergenic
1174157786 20:48528032-48528054 GGAGGAGCCGCAGGAGAGCAGGG - Intergenic
1174449519 20:50610711-50610733 GGGGCAGCTGCAGGAGGCTAAGG - Intronic
1175093154 20:56521121-56521143 GGGAGAGCTGCAGGAGACCAGGG + Intronic
1175462259 20:59160365-59160387 AGGGGCCGTGCAGGAGCCCAGGG + Intergenic
1175992452 20:62796548-62796570 GGGGGCGCCGCAGGCGACAAGGG + Exonic
1176067124 20:63203698-63203720 GGGTCCCCTGCAGTAGACCACGG + Exonic
1176210253 20:63916682-63916704 GAGGGTACTGCAGGAGACCAGGG + Intronic
1176383571 21:6126024-6126046 GGGGCCGCCTCAGGACACCAAGG + Intergenic
1176443340 21:6798533-6798555 GGGACAGCAGCAGGAGACCAGGG + Intergenic
1176451452 21:6865787-6865809 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1176458196 21:6931064-6931086 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1176634243 21:9174296-9174318 AGGGGCCCTCCAGGAGACCTAGG - Intergenic
1176821508 21:13663580-13663602 GGGACAGCAGCAGGAGACCAGGG + Intergenic
1176829620 21:13730838-13730860 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1176836370 21:13796159-13796181 AAGGGTACTGCAGGAGACCAGGG + Intergenic
1176879951 21:14180121-14180143 GAGGGTACTGCAGGAGACCAGGG - Intronic
1176885425 21:14249747-14249769 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1176914643 21:14610328-14610350 GGGGGCACTGCAGGAGACTAGGG - Intronic
1177213276 21:18096563-18096585 GAGGGCACTGCAGGAGACCAGGG - Intronic
1177984742 21:27960655-27960677 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1177993956 21:28072800-28072822 GGGGGTGCTACGGGAGACCAGGG - Intergenic
1178552506 21:33552673-33552695 GGGGGCTCTTCAGGAGGCAAAGG - Exonic
1178638887 21:34330032-34330054 TGGGGTGGTGCAGGATACCAGGG - Intergenic
1178858268 21:36268137-36268159 GAGGGTACTGCAGGAGACCAGGG + Intronic
1179515804 21:41905755-41905777 GGGGGCGCTGCGGCAGGCGATGG + Exonic
1179531379 21:42021921-42021943 AGGGGCGCTGCAGGAGGCCGGGG + Intergenic
1179739899 21:43412214-43412236 GGGGCCGCCTCAGGACACCAAGG - Intergenic
1179935532 21:44601592-44601614 GGGGGCGCAGCAGGAGGGGACGG - Exonic
1180234439 21:46448993-46449015 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1180331914 22:11488920-11488942 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1180894559 22:19320316-19320338 GGGAGCGCTACGGGAGACCGGGG + Intergenic
1180990872 22:19935299-19935321 GAGGGTACTGCAGGAGACCAGGG - Intronic
1181377201 22:22469039-22469061 GGGAGCGCTGCAGGAGACCAGGG - Intergenic
1181536225 22:23547431-23547453 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1181625174 22:24118236-24118258 GGGTGGGCTGCAGGGGAGCAGGG + Intronic
1183174085 22:36209788-36209810 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1183638764 22:39080875-39080897 GGGGGAGCAGGAGGAGAGCAGGG - Intronic
1184062934 22:42095776-42095798 GGGAGCGCTACAGGAGACTGGGG - Intergenic
1184210964 22:43035402-43035424 CAGGGCCCTGCAGGAGACCTTGG + Intergenic
1184399183 22:44263775-44263797 CGGGGCCCTGCTGGAGGCCACGG - Intronic
1184632661 22:45796208-45796230 GAGGGCGCTGCAGGAGACCAGGG - Intronic
1184709990 22:46244192-46244214 GGGGGTGCTGCAGGAACCCCCGG + Exonic
949213615 3:1537044-1537066 GGAGGTACTGCAGAAGACCAAGG - Intergenic
949366919 3:3291877-3291899 GAGGGTACTGCAGGAGACCAGGG - Intergenic
949787889 3:7761768-7761790 GGGAGAGCTACAGGAGACCAGGG - Intergenic
950073277 3:10169350-10169372 GAGGGCACTGCAGGAGACCAGGG + Intronic
950198608 3:11027188-11027210 GGGAGCGCTACGGGAGACCGGGG + Intronic
950231264 3:11277808-11277830 GAGGGTACTGCAGGAGAACAGGG + Intronic
950912154 3:16605526-16605548 GGGGGGGCTGCGGGGGACGACGG + Intronic
951081015 3:18449773-18449795 GAGGGTACTGCAGGAGACCAGGG + Intergenic
951212225 3:19988375-19988397 GGGGGTGCTACAGGAGACTGGGG - Intronic
951302010 3:21009692-21009714 GGGGGCGCTGCAGGAGACTCGGG - Intergenic
951842747 3:27051734-27051756 GAGGGCACTGCAGGAAACCAGGG - Intergenic
951859574 3:27236929-27236951 CAGGGTACTGCAGGAGACCAGGG + Intronic
952288799 3:31995248-31995270 GAGAGTACTGCAGGAGACCAGGG + Intronic
952293792 3:32043074-32043096 GAGGGTACTGCAGGAGACCAGGG + Intronic
952397150 3:32930889-32930911 GGCGGAGCTGCTGAAGACCATGG + Intergenic
953414652 3:42708765-42708787 TGGGACACTGCAGGAGACCCTGG - Exonic
953509231 3:43518717-43518739 GGGGGCACTACAGGAGACCGGGG - Intronic
953846561 3:46432085-46432107 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
953987935 3:47459867-47459889 GAGGGTACTGCAGGAGACCAGGG + Intronic
954218973 3:49141003-49141025 GAGGGTACTGCAGGAGACCAGGG - Intergenic
954662004 3:52231318-52231340 GGGGGCGCTGGGGGAGTCCAAGG - Intronic
954738663 3:52728886-52728908 GAGGGTACTGCAGGAGACCAGGG - Intronic
954795041 3:53157045-53157067 GGGGGCGGTGGAGGAGAGCTGGG + Intronic
955148885 3:56347390-56347412 GGGGGCGCTGGAGGAAAGCTGGG + Intronic
956315446 3:67930545-67930567 GAGGGTACTACAGGAGACCAGGG + Intergenic
956552633 3:70478919-70478941 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
956715472 3:72076015-72076037 GAGGGCACTGCAGGAGACCAGGG + Intergenic
957090729 3:75727582-75727604 GAGGGTACTGCAGGAGACCAGGG - Intronic
957138182 3:76316237-76316259 GAGGGTACTGCAGGAGACCAGGG + Intronic
957353179 3:79052269-79052291 GGGGGTGCTGCAGGAGACGAGGG - Intronic
957354142 3:79060121-79060143 GGGGATGCTGCAGGAGACTAGGG - Intronic
957623083 3:82620897-82620919 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
957756263 3:84492133-84492155 GGGGGCACTGCAGGAGACTAGGG - Intergenic
957778941 3:84793349-84793371 GGGGGTGCTGCAGGAGGCCAGGG - Intergenic
958193955 3:90219091-90219113 GAGGGTACTGCAGGAGACCAGGG - Intergenic
958417308 3:93890145-93890167 GAGGGTACTGCAGGAGACCCGGG - Intronic
958424387 3:93964459-93964481 GAGGGTACTGCAGGAGACCAGGG - Intronic
958621907 3:96573193-96573215 GAGGGTACTGCAGGAGACCAGGG + Intergenic
958625268 3:96614905-96614927 GGGAGCGCTACTGGAGACCGGGG + Intergenic
959005250 3:101012446-101012468 GAGGGTACTGCAGGAGACCAGGG + Intergenic
959220065 3:103506845-103506867 GAGGGTACTGCAGGAGACCAGGG + Intergenic
959224655 3:103564330-103564352 GAGGGCACTGCAGTAGACCAGGG - Intergenic
959261666 3:104090100-104090122 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
959508152 3:107177807-107177829 GGGGGAGCTGCCCAAGACCATGG - Intergenic
959729421 3:109583956-109583978 GAGGGTACTGCAGGAGACCAGGG - Intergenic
959936746 3:112037358-112037380 GGGGGTGCTGCAGGAGACTAGGG - Intronic
960646359 3:119888881-119888903 GAGGGTACTGCAGGAGACCAGGG - Intronic
960890638 3:122443988-122444010 GAGGGCACTGAAGGAGACCAGGG + Intronic
960938286 3:122916736-122916758 GTGGGTGCTCCAGGTGACCATGG - Intronic
961171733 3:124802068-124802090 TGTGGCACTGCAGGAGCCCAAGG - Intronic
961268818 3:125671963-125671985 CGGGGCCATGCAGGAGCCCACGG - Intergenic
961740006 3:129027303-129027325 GGAGGCGCTGCAGGGGGCCCCGG + Intronic
961898338 3:130188007-130188029 TTGGGTACTGCAGGAGACCAGGG - Intergenic
961919206 3:130408361-130408383 GGGGGCGTTGCAGGAGACCAGGG - Intronic
962169750 3:133088340-133088362 GAGGGCTTTGGAGGAGACCATGG + Intronic
962367491 3:134795948-134795970 GCGGGGGCTGCGGGAGACCGAGG - Intronic
962497582 3:135957406-135957428 GAGGGCACTGCAGGAGAACAGGG + Intergenic
962758533 3:138486721-138486743 GAGGGTACTGCAGGAGACCAAGG + Intergenic
962764136 3:138545799-138545821 GAGGGTACTGCAGGAGACCAGGG - Intronic
963292234 3:143503688-143503710 GTGGCCGCTCCGGGAGACCATGG - Intronic
963344025 3:144072036-144072058 GAGGGTACTGCAGGAGACCAGGG + Intergenic
963439283 3:145316521-145316543 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
963441405 3:145344736-145344758 GGTGGAGCTGCTGAAGACCATGG - Intergenic
963473275 3:145771375-145771397 GAGGGTACTGCAGGAGACCAGGG + Intergenic
964180250 3:153874764-153874786 GAGGGTACTGCAGGAGACCAGGG + Intergenic
964840084 3:160984140-160984162 TGGGGCACTGCAGGAGACTAGGG + Intronic
965068103 3:163878587-163878609 GAGGGCACTGCAGGAGACCAGGG + Intergenic
965089734 3:164147669-164147691 GAGGGTACTGCAGGAGACCAGGG - Intergenic
966511767 3:180772167-180772189 GAGGGTACTGCAGGAGACCAGGG + Intronic
966831969 3:184017657-184017679 GAGGCGGCGGCAGGAGACCAGGG + Intronic
967265301 3:187686185-187686207 GAGGGTACTGCAGGAGCCCAGGG - Intergenic
967300881 3:188010827-188010849 GAGGGTACTGCAGGAGACCAGGG + Intergenic
967651733 3:191994129-191994151 GGGAGTGCTGCGGGAGACCGGGG + Intergenic
967701993 3:192603919-192603941 GAGGGTACTGCAGAAGACCAGGG + Intronic
967778823 3:193413672-193413694 GAGGGTACTGCAGGAGATCAGGG - Intronic
968041093 3:195589946-195589968 GAGGGTACTGCAGGAGACCAGGG + Intergenic
968174020 3:196533530-196533552 GGGGGCGCCGCAGGAGAGCAGGG + Intergenic
968342431 3:197967728-197967750 GAGGGTACTGCAGGAGACCAGGG + Intronic
968551179 4:1224017-1224039 GGGGCAGCTGCTGGTGACCACGG + Intronic
968904719 4:3445941-3445963 GGAGGCGCTGCAGAGGGCCATGG - Intronic
969008525 4:4041471-4041493 TTGGGTACTGCAGGAGACCAGGG - Intergenic
969093801 4:4717473-4717495 GGGGGAGCAGGTGGAGACCAGGG - Intergenic
969392813 4:6902257-6902279 GGAGGGGCTGCGGGAGCCCAGGG + Intergenic
969745156 4:9064905-9064927 TTGGGTACTGCAGGAGACCAGGG + Intergenic
969804449 4:9595918-9595940 TTGGGTACTGCAGGAGACCAGGG + Intergenic
969841971 4:9889301-9889323 TGGGGCACTGGAGGAGACAAGGG + Intronic
969885745 4:10213775-10213797 GAGTGTTCTGCAGGAGACCAGGG + Intergenic
970057979 4:11996746-11996768 GAGGGTACTGCAGGAGACCAGGG + Intergenic
970448616 4:16145196-16145218 GAGGGTACTGCAGGAGACCAGGG - Intergenic
970547023 4:17140172-17140194 GAGGGTACTGCAGGAGACCAGGG - Intergenic
970722332 4:19002401-19002423 TAGGGCACTGCAGAAGACCAGGG + Intergenic
970742646 4:19255758-19255780 GGGAGCGCTACGGGATACCAGGG + Intergenic
971319928 4:25597271-25597293 GAAGGTACTGCAGGAGACCAGGG + Intergenic
971332272 4:25691723-25691745 GAGGGCACTGCAGGAGACCAGGG + Intergenic
971405173 4:26315700-26315722 GAGGGTACTGCAGGGGACCAGGG + Intronic
971603858 4:28631628-28631650 GAGGGCACTGCAGGAGACCAGGG + Intergenic
971753845 4:30682977-30682999 GAGGGTACTGCAGGAGACCAGGG + Intergenic
971846725 4:31928317-31928339 GAGGGTACTGCAGGAGACCAGGG - Intergenic
972362389 4:38339085-38339107 GAGGGTACTGCAGGACACCAGGG + Intergenic
972897198 4:43638127-43638149 GGGGGCGCTGCAGGAGGCCAGGG - Intergenic
972940694 4:44191640-44191662 GAGGGTACTGCAGGAGACCAGGG - Intronic
973024315 4:45248290-45248312 GAGGGTACTCCAGGAGACCAGGG + Intergenic
973040213 4:45460359-45460381 GGGGGCACTGCAGGAGACCAGGG - Intergenic
973223316 4:47753458-47753480 GAGGGTACTGCAGGAGACCAGGG + Intronic
973243992 4:47990389-47990411 GAGGGTACTGCAAGAGACCAGGG - Intronic
973799255 4:54460288-54460310 GAGGGTACTGCAGGAGACCAGGG - Intergenic
973799904 4:54467196-54467218 GAGGGTACTGCAGGAGACCATGG - Intergenic
973851176 4:54963111-54963133 GGTGGCACTGCCAGAGACCAGGG + Intergenic
974199437 4:58620171-58620193 GGGAGCGCTGCAGGAGACTGGGG - Intergenic
974214743 4:58829966-58829988 GGGAGCACTACAGGAGACCATGG + Intergenic
974605767 4:64147520-64147542 GAGGGTACTGCAGGAGGCCAGGG + Intergenic
974645599 4:64687312-64687334 GAGGGTACTGCAGGAGACCAGGG - Intergenic
974741401 4:66012931-66012953 GAGGGTACTGCAGGAGACCAGGG - Intergenic
974892255 4:67896625-67896647 TGGGGCCGTGCAGGAGCCCACGG + Intergenic
974961214 4:68703410-68703432 GAGGGTACTGCAGGAGACCAGGG - Intergenic
974986558 4:69034440-69034462 GGGGGCACTACAGGAGACCAGGG - Intronic
974999167 4:69198760-69198782 GAGGGTACTGCAGGAGACCAGGG - Intronic
975016293 4:69424892-69424914 GAGGGTACTGCCGGAGACCAGGG + Intergenic
975228658 4:71905539-71905561 GAGGGTACTGCAGGAGACCAGGG - Intergenic
975307691 4:72867676-72867698 GAGGGTACTGCAGGAGACCAGGG + Intergenic
975722786 4:77264387-77264409 GAGGGTTCTGCAGGAGACCAGGG + Intronic
975729127 4:77320417-77320439 GAGGGTACTGCAGGAGACCAGGG + Intronic
975790634 4:77946059-77946081 GAGGGTGCTGCAGGAGACCAGGG + Intronic
975819248 4:78253024-78253046 GAGGGTACTGCAGGAGACCAGGG + Intronic
975897907 4:79117251-79117273 GAGGGTACTGCAGGAGACCAGGG - Intergenic
976363410 4:84206462-84206484 GAGGGTACTGCAGGAGACCAGGG + Intergenic
976453241 4:85216774-85216796 GAGGGTACTGCAGGAGACCAGGG - Intergenic
976636766 4:87294026-87294048 GAGGATACTGCAGGAGACCAGGG + Intergenic
976693057 4:87889333-87889355 GGGAGCGCTATGGGAGACCAGGG + Intergenic
976741822 4:88364470-88364492 GAGGGTACTGCAGGAGACCAGGG + Intergenic
976803093 4:89015095-89015117 GGGAGCGCTACAGGAGACCAGGG - Intronic
976971128 4:91104058-91104080 AAGGGTACTGCAGGAGACCAGGG - Intronic
976983054 4:91256212-91256234 GGGGGCCCTGCAGGAGACCAGGG - Intronic
977063740 4:92288007-92288029 GGTGGAGCTGCACAAGACCATGG - Intergenic
977354339 4:95926466-95926488 GAGGGTACTGCAGGAGACCAGGG - Intergenic
977548398 4:98413097-98413119 GAGGGTACTGCAGGAGACCAGGG + Intronic
977720224 4:100231045-100231067 GAGGGTACTGCAGGGGACCAGGG + Intergenic
977927642 4:102719109-102719131 GAGGGTACTGCAGGAGACCAGGG + Intronic
978036575 4:104002475-104002497 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
978083342 4:104621054-104621076 GGTGGAGCTGCCGAAGACCATGG - Intergenic
978193789 4:105946942-105946964 GAGGGTACTGCAAGAGACCAGGG + Intronic
978357626 4:107893631-107893653 GGGGGCTCTGCAGAAGGACAAGG + Intronic
978369820 4:108018773-108018795 GGTGGCGCTGCAGGAAAGCCTGG + Intronic
978467272 4:109021844-109021866 GAGGGTACTGCAGGAGACCAGGG - Intronic
978505620 4:109453357-109453379 GGGGGTGCTGCTGGAGGCCAGGG + Intronic
979027215 4:115592789-115592811 GAGGGTACTGCAGGAGACCAGGG - Intergenic
979075093 4:116260979-116261001 GGGGGTACTGCAGGAGACCAGGG - Intergenic
979351216 4:119646426-119646448 GTGGGTGCTCCAGGAAACCAGGG - Intergenic
979400614 4:120245146-120245168 GAGGGTACTGCAGGAGACCAGGG + Intergenic
979458048 4:120948597-120948619 GGGGGCACTGCAGGAGACCAAGG + Intergenic
979503606 4:121468049-121468071 GAGGGTACTGCAGGAGACCAGGG + Intergenic
979609055 4:122670502-122670524 TTGGGCCCTGCAGGAGCCCACGG - Intergenic
979765588 4:124461825-124461847 GAGGGTACTGCAGGAGACCAGGG - Intergenic
979810819 4:125033725-125033747 GAGGGTACTGCAGGAGACCAGGG - Intergenic
979993830 4:127407665-127407687 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
980046656 4:127996665-127996687 GAGGGTACTGCAGGACACCAGGG + Intronic
980073287 4:128265716-128265738 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
980158151 4:129131561-129131583 GAGGGTACTGCAGGAGACCCAGG - Intergenic
980180938 4:129399721-129399743 GAGGGAACTGCAGGAGAACAGGG + Intergenic
980201245 4:129658531-129658553 GGTGGAGCTGCTGAAGACCATGG - Intergenic
980298619 4:130957799-130957821 GAGGGTACGGCAGGAGACCAGGG + Intergenic
980337631 4:131496445-131496467 GAGGGCACTGCAGGAGACCAGGG + Intergenic
980473388 4:133278098-133278120 GAGGGTACTGCAGGAGACCAGGG + Intergenic
980577207 4:134698913-134698935 GGGGGTGCTGCAGGAGGCCAGGG - Intergenic
980613118 4:135183869-135183891 GAGGGTTCTGCAGGACACCAGGG + Intergenic
980638312 4:135538801-135538823 GGGAGTGCGGCAGGAGAACAGGG - Intergenic
980807370 4:137830922-137830944 GAGGGTACTGCAGGAGACCAGGG + Intergenic
980954512 4:139414825-139414847 GAGGGTACTGCAGGAGACCAGGG - Intronic
981190378 4:141855656-141855678 GAAGGCACTGCAGGAGACCAGGG - Intergenic
981754167 4:148123174-148123196 GAGGGTACTGCAGGAGACCAGGG - Intronic
981782883 4:148445571-148445593 GGGGGCGCGCCAGGAGACGCGGG - Intergenic
982206187 4:152998935-152998957 GGCGGCGCTGGAGGAGAGGATGG + Intergenic
982391945 4:154874198-154874220 GGGGGCGCTACAGGAGACTGGGG + Intergenic
982479433 4:155891266-155891288 GAGGGCACTGCAGGAGACCAGGG + Intronic
982513660 4:156317333-156317355 GAGGGTACTGCAGGAGACCAGGG + Intergenic
982587260 4:157258405-157258427 GGGAGCGCTACAGGAGACTGGGG - Intronic
982727449 4:158920565-158920587 GAGGGTACTGCAGGAGACCAGGG - Intronic
983032248 4:162817602-162817624 GAGGGTACTGTAGGAGACCAGGG - Intergenic
983189601 4:164740928-164740950 GAGGGTACTGCAGGAGATCAGGG - Intergenic
983190933 4:164752774-164752796 GAGGGTACTGCAGGAGACCAGGG - Intergenic
983290632 4:165799467-165799489 TTGGGCGGTGCAGGAGACCAGGG + Intergenic
983303426 4:165956327-165956349 GAGGGTACTGGAGGAGACCAGGG + Intronic
983304371 4:165966967-165966989 GGGGGCGCTACAGAAGACCAGGG + Intronic
983759527 4:171387708-171387730 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
984157785 4:176212407-176212429 GAGGGTACTGCAGGAGACCAGGG - Intergenic
984324625 4:178236293-178236315 GGGAGCGCTATGGGAGACCAGGG + Intergenic
984474122 4:180215577-180215599 GGGGCCTCAGCAGGAGTCCACGG - Intergenic
984548095 4:181130480-181130502 GGGAGCGCTGCAGGAGACCAGGG + Intergenic
984905963 4:184626047-184626069 GGGGGCGTTGCAGGAGGCCAGGG + Intergenic
985037689 4:185857769-185857791 GAGGGCACTGCAGGAGACCAGGG - Intronic
985307073 4:188555091-188555113 AGGGGCGCGGCAGGAGATGAGGG - Intergenic
985332273 4:188851385-188851407 GAGGGTACTGCAGGAGACCAGGG - Intergenic
985362399 4:189189519-189189541 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
985530590 5:431612-431634 GGGGCCGCTGCTGGGGGCCATGG - Intronic
985704759 5:1393868-1393890 GGGGGCCCTGCATGCGTCCAGGG + Exonic
986758183 5:10856955-10856977 GGCTGCGCTGCAGGAGAGGAAGG - Intergenic
986950155 5:13073079-13073101 GAGGGTACTGCAGGAGACCAGGG + Intergenic
987079193 5:14411091-14411113 TGGGGCACTGCAGGAGATCCAGG + Intronic
987571935 5:19675367-19675389 GGGAGCGCTACTGGAGACCGGGG + Intronic
987689746 5:21251654-21251676 GGGGGTGCTGCAGGAGACTAGGG - Intergenic
987978276 5:25044404-25044426 GAGGGTACTGCAGGAGACCAGGG + Intergenic
988245514 5:28675408-28675430 GGGAGCACTACAGGAGACCGGGG + Intergenic
988396674 5:30704650-30704672 GAGGGTACTGCAGGAAACCAGGG + Intergenic
988720207 5:33869865-33869887 GGGGGCGCTGCAGGAGACTAGGG + Intronic
988723918 5:33906465-33906487 GAGGGTACTGCAGGAGACCAGGG - Intergenic
988808976 5:34766366-34766388 GGCGGAGCTGCACAAGACCATGG + Intronic
988809243 5:34768127-34768149 GGCGGAGCTGCACAAGACCATGG + Intronic
989387096 5:40864927-40864949 GAGGGTACTGCAGGAGACCAGGG - Intergenic
989420277 5:41230464-41230486 GAGGGTGCTACAGGAGACCAGGG - Intronic
989513915 5:42319758-42319780 CGGGGCGCTGCAGGAGACCAGGG + Intergenic
989828667 5:45889631-45889653 GGGGATGCTTCAGGAGACAAGGG + Intergenic
989830790 5:45915719-45915741 GTTGGTGCTGCAGGAGACTAAGG + Intergenic
990878170 5:60510116-60510138 AATGGCTCTGCAGGAGACCAGGG + Intronic
991101377 5:62797201-62797223 CAGGGTTCTGCAGGAGACCAGGG + Intergenic
991250782 5:64558872-64558894 GGGGGCGCTGCAGGAGGCCAGGG - Intronic
991264100 5:64696654-64696676 GAGGGTACTGCAGGAGACCAGGG - Intronic
991712557 5:69422458-69422480 GGGAGCACTACAGGAGACCAGGG - Intronic
991899692 5:71447364-71447386 GACGGCCCTGCAGGAGACCCAGG + Intergenic
992820748 5:80493668-80493690 GAGGGTACTGCAGGAGGCCAGGG - Intronic
992860334 5:80902785-80902807 GGGGGTGCTGCAGGAGGCCAGGG + Intergenic
993172429 5:84435991-84436013 GAGGGTACTGCAGGAGACCAGGG - Intergenic
993367248 5:87049197-87049219 GGGGGTGCTGTAGGAGACCAGGG + Intergenic
993411293 5:87576468-87576490 GGGGGCGCTGCAGGAGGCCAGGG - Intergenic
993533336 5:89050294-89050316 GAGGGTACTGCAGGAGACCGGGG - Intergenic
993750330 5:91658015-91658037 GAGGGTACTGCAGGAGACCAGGG - Intergenic
993834129 5:92795792-92795814 GAAGGTACTGCAGGAGACCAGGG + Intergenic
994386935 5:99143676-99143698 GAGGGTACTGCAGGAGACCAGGG + Intergenic
994615445 5:102098963-102098985 GAGGGTACTGCAGGAGACCAGGG + Intergenic
994744694 5:103663998-103664020 GGGAGTGCTACGGGAGACCAGGG + Intergenic
994813009 5:104547101-104547123 GAGGGTACTGCAGGAGACCAGGG - Intergenic
994875815 5:105419478-105419500 GAGGGTACTGCAGGAGACTAGGG + Intergenic
994877041 5:105437078-105437100 GAGGGTACTGCAGGAGACAAGGG + Intergenic
995019072 5:107346733-107346755 GGGGGCGCTGCAGGAGACTAGGG + Intergenic
995187416 5:109286766-109286788 GAGGGTACTGCAGGAGACCAGGG + Intergenic
996044248 5:118851940-118851962 GAGGGTACTGCAGGAGACCAGGG + Intronic
996097461 5:119414087-119414109 GAGGGTACTGAAGGAGACCAGGG - Intergenic
996101658 5:119450988-119451010 GAGGGTACTGCAGGAGACCAGGG + Intergenic
996146857 5:119987236-119987258 GAGGGCGCTGCAGGAGACCAGGG + Intergenic
996434863 5:123423144-123423166 GGGCGCGCTGCAGCAGACGGCGG - Exonic
996517118 5:124383097-124383119 GAGGGTACTGCAGGAGACCAGGG - Intergenic
996667195 5:126073429-126073451 GAGGGTACTGCAGGAGATCAGGG - Intergenic
997004208 5:129799500-129799522 GAGGGTACTGCAGGAGACCAGGG + Intergenic
997115714 5:131123862-131123884 GAGGGTACTGCAGGAGACCAGGG - Intergenic
997489643 5:134262821-134262843 GAGGGCACTGCAGGAGACCAGGG + Intergenic
997491905 5:134284607-134284629 GAGGGCACTGCAGGAGACCAGGG + Intergenic
997564182 5:134874544-134874566 GGGGGCGGTGCATGAGATGATGG + Intronic
997694383 5:135849976-135849998 GAGGGAGAAGCAGGAGACCAGGG + Intronic
997736991 5:136220473-136220495 GAGGGTACTGCAGGAGACCAGGG - Intronic
998315288 5:141177788-141177810 GGTGGCGCTGCAGGATAAGAAGG + Exonic
998319214 5:141213876-141213898 GGTGGCGCTGCAGGATAAGAAGG + Intergenic
998321203 5:141234292-141234314 GGTGGCGCTGCAGGATAAGACGG + Intergenic
998647674 5:144081581-144081603 GAGGGTACTGCAGGAGACCAGGG - Intergenic
998969994 5:147580638-147580660 GAGGGTACTGCAGGAGACCAGGG - Intergenic
999412849 5:151367260-151367282 GAGGGTTCTGCGGGAGACCAGGG + Intergenic
999431358 5:151528013-151528035 GGGGGAGCTACAGGTGGCCAAGG - Exonic
999457508 5:151729802-151729824 GAGGGCACTGCAGGAGACCAGGG + Intergenic
999901462 5:156090689-156090711 GAGGGCACTGCAGGAGACCAGGG + Intronic
1000237942 5:159380186-159380208 GAGGATACTGCAGGAGACCAGGG + Intergenic
1000400971 5:160826828-160826850 GAGGGTACTGCAGGAGACCAGGG - Intronic
1000735406 5:164893225-164893247 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1001361576 5:171091183-171091205 GGTGGAGCTGCCCGAGACCATGG + Intronic
1001666916 5:173440872-173440894 GGAGGCTGTGCAGGAGTCCAGGG - Intergenic
1001870140 5:175146952-175146974 TGAGGTTCTGCAGGAGACCAGGG - Intergenic
1002071481 5:176681101-176681123 GGGGCCCCTGAAGGAGTCCAGGG + Intergenic
1002391494 5:178916136-178916158 GAGGGCCCAGCAGGAGAACATGG + Intronic
1002481285 5:179502621-179502643 GGGAGAGCTGCAGGAGGCGAGGG + Intergenic
1002712661 5:181204588-181204610 CGAGGCGGTGCAGGAGGCCAAGG - Exonic
1002732879 5:181354720-181354742 GGTGGAGCTGCCTGAGACCATGG + Intergenic
1002751659 6:119384-119406 GGTGGAGCTGCCTGAGACCATGG - Intergenic
1003176899 6:3758407-3758429 TGGGGCAGTGCAGGAGCCCACGG - Intergenic
1003224427 6:4191358-4191380 GCGGGCTATGCAGGAGCCCACGG + Intergenic
1003923299 6:10853957-10853979 GAGGGTACTGCAGGAGACCAGGG - Intronic
1004045324 6:12017993-12018015 TGGGGCCGTGCAGGAGCCCATGG + Intronic
1004230558 6:13829328-13829350 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1004267230 6:14159265-14159287 GGGGGTGCTGCAGGAGACCAGGG + Intergenic
1004672119 6:17807426-17807448 GAGGGTACTGCAGGAGACCAGGG - Intronic
1005373404 6:25158054-25158076 AAGGGTTCTGCAGGAGACCAGGG - Intergenic
1005985261 6:30869442-30869464 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1006041971 6:31263653-31263675 GAGGGTTCTGCAAGAGACCAGGG + Intergenic
1006115885 6:31776032-31776054 AGGGGCTCTGCGGGAGACCGTGG - Exonic
1006145792 6:31958916-31958938 GCGGGCGCGGCCGGAGACCGTGG - Exonic
1006286671 6:33101309-33101331 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1006292717 6:33152302-33152324 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1006793925 6:36720473-36720495 GGGGCAGCTGCAGGTGACCAGGG + Exonic
1007038416 6:38699693-38699715 GAGGGTACTGCAGGAGACGAGGG - Intronic
1007354051 6:41297506-41297528 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1007408271 6:41647157-41647179 GGGTGTGCTGGAGGAGACCGAGG - Intronic
1007498328 6:42277153-42277175 GTGGGAGCTGCAGGAGTCTAGGG + Intronic
1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG + Intronic
1007609809 6:43142109-43142131 AGGGGGGCTGCAGGAGAGGAGGG - Intronic
1008044963 6:46842493-46842515 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1008167186 6:48152852-48152874 GAGGGTACTGCGGGAGACCAGGG - Intergenic
1008502804 6:52200241-52200263 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1009039074 6:58155953-58155975 GGGAGCACTGCAGGAGGCCAGGG - Intergenic
1009214967 6:60910792-60910814 GGGAGCGCTGCAGGAGGCCAGGG - Intergenic
1009245891 6:61237228-61237250 GGGGGCACTGCAGGAGACCAGGG - Intergenic
1009447244 6:63757289-63757311 GAGGGTACTGCAGGAAACCAGGG - Intronic
1009630852 6:66198272-66198294 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1009720179 6:67458445-67458467 GAGGGTACTGCAGTAGACCAGGG + Intergenic
1009766647 6:68085777-68085799 GAGGGCACTGCGGGAGACCAGGG + Intergenic
1009789651 6:68385534-68385556 GAGGGTACTACAGGAGACCAGGG - Intergenic
1010465051 6:76158021-76158043 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1010520273 6:76823852-76823874 GAGAGTACTGCAGGAGACCAGGG + Intergenic
1010776406 6:79891197-79891219 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1010796525 6:80122874-80122896 GAGGGTACTGCAGGAGACCAGGG + Intronic
1010803905 6:80212233-80212255 GAGGGTACTGCAGGAGACCAGGG + Intronic
1010810585 6:80294672-80294694 GAGGGTACTGCAGGAGACCAGGG - Intronic
1010816619 6:80365341-80365363 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1011357649 6:86489223-86489245 GGGGGCACTGTGGGAGACCAGGG - Intergenic
1011590877 6:88969585-88969607 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1011608540 6:89128325-89128347 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1011681009 6:89783349-89783371 GAGGGTACTGCAGGAGACCAGGG - Intronic
1012138103 6:95584461-95584483 TGGGGTACTGGAGGAGACCAGGG - Intronic
1012168571 6:95989995-95990017 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1012213697 6:96556624-96556646 GGGGGAGCTGCCCAAGACCATGG - Intergenic
1012380754 6:98616506-98616528 GGGGGCACTGCAGGAGACTAGGG + Intergenic
1012607133 6:101171224-101171246 GAGGATACTGCAGGAGACCAAGG + Intergenic
1012682315 6:102197355-102197377 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1012704451 6:102503521-102503543 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1012746183 6:103092586-103092608 GAGGGTTCTGCAGGAGACGAGGG - Intergenic
1013009840 6:106110048-106110070 GAGGGTGCTGCAGAAGAACAGGG - Intergenic
1013500272 6:110742702-110742724 GAGGGTACTGCAGGAGACCAGGG - Intronic
1013560616 6:111301139-111301161 GGGGGTGCTGCAGGAGGCCAGGG - Intronic
1013664112 6:112329008-112329030 GGGGGTGCTGCAGAAGACTAGGG + Intergenic
1013855242 6:114564538-114564560 GAGGGTGCTGCAGGAGACCAGGG - Intergenic
1013920954 6:115402828-115402850 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1013927748 6:115493517-115493539 GGGGGCACTGCAGGAGACTAGGG + Intergenic
1014290664 6:119554138-119554160 GGGAGCGCTACGGGAGACCAGGG - Intergenic
1014320728 6:119925084-119925106 GAGGGTACTGCGGGAGACCAGGG + Intergenic
1014469503 6:121797808-121797830 GGGGGCGCTGCAGGAGACCATGG - Intergenic
1015341862 6:132109921-132109943 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
1015378164 6:132534498-132534520 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1016108231 6:140188835-140188857 GGTGGAGCTGCATAAGACCATGG + Intergenic
1016534834 6:145098271-145098293 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1016855488 6:148666314-148666336 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1016865793 6:148764902-148764924 GGGGGTGCTGCAGGAGACTAGGG + Intronic
1017177577 6:151519133-151519155 GAGGGTACTGCAAGAGACCAGGG + Intronic
1017399237 6:154039953-154039975 GGGGACTCTGGAGGAGACCACGG + Intronic
1017850095 6:158297898-158297920 GAGGGTACTGTAGGAGACCAGGG + Intronic
1017855330 6:158345839-158345861 GAGGGTACTGCAGGAGACCAGGG + Intronic
1017888705 6:158621934-158621956 GGGCGAGCTGCGGGAGCCCATGG - Intronic
1018059846 6:160081595-160081617 GGGGGCGCTGCAGGAGGCCAGGG + Intronic
1018102159 6:160450148-160450170 GAGGGTACTGCAGGAGGCCAGGG + Intronic
1018706396 6:166466553-166466575 GGGGGAGCTGCAGGTGGGCAGGG - Intronic
1019002839 6:168769986-168770008 GGGGGTGCTGCAGGAGGCCAGGG + Intergenic
1019072099 6:169355221-169355243 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1019237132 6:170627038-170627060 GGTGGAGCTGCCTGAGACCATGG + Intergenic
1019537852 7:1538325-1538347 GGGGCCGCAGCCAGAGACCAGGG - Intronic
1019554050 7:1619842-1619864 GGGGACCCTGCAGGTGGCCAGGG - Intergenic
1019736061 7:2650214-2650236 GGGGGAGCGGCAGGTGACCCAGG + Intronic
1019740498 7:2670564-2670586 GGGGGCGCTGCAGCTGGGCACGG + Intergenic
1019853060 7:3578534-3578556 GAGAGTACTGCAGGAGACCAGGG + Intronic
1019873235 7:3786852-3786874 GGGGGAGCTGCAGGAGCCAAAGG - Intronic
1020328992 7:6999264-6999286 TTGGGTACTGCAGGAGACCAGGG - Intergenic
1020603586 7:10307108-10307130 TGGGGTGCTGCAGGAGACCAGGG - Intergenic
1020788995 7:12602502-12602524 GAGGGTACTCCAGGAGACCAGGG + Intronic
1021109668 7:16679140-16679162 GGGGGTGCTGCAGGAGACCAGGG + Intronic
1021176805 7:17459028-17459050 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1022020468 7:26395680-26395702 GGGAGCGGTGCAGGAGAGCAGGG - Intergenic
1022686765 7:32604270-32604292 GGGGGCGCTGCAGGAGACTAGGG + Intergenic
1023074085 7:36466049-36466071 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1023668855 7:42555149-42555171 GGGGGCGCTGCAGGAGACTAGGG - Intergenic
1023678197 7:42653078-42653100 CTGGGAGCTGCAGAAGACCAAGG - Intergenic
1023862708 7:44225679-44225701 GGGGCTGCTGCAGGCGGCCAGGG - Intronic
1024021377 7:45373861-45373883 GGTGGGGCTGCCCGAGACCATGG - Intergenic
1024122797 7:46261859-46261881 GGGAGCGCTACGGGAGACCGGGG - Intergenic
1024213078 7:47223650-47223672 GGGAGCGCTACGGGAGACCGGGG - Intergenic
1024223312 7:47304677-47304699 TGGGGCGGGGCAGGGGACCAGGG - Intronic
1024262268 7:47581720-47581742 GGGGGCTCGGCAGGAGTCCCAGG - Intronic
1024403304 7:48949362-48949384 GAGGGTACTGCAAGAGACCAGGG + Intergenic
1024408822 7:49015023-49015045 GGGCATGCTGCAGGAGACTAGGG + Intergenic
1024525782 7:50348013-50348035 GGGGGCCATGCAGGGGACCAAGG + Intronic
1024552025 7:50570464-50570486 AGGGGCACTGCAGGAGGCCAGGG - Intergenic
1024553501 7:50583490-50583512 GCGGGCGCTGCAGGAGGCCAGGG - Intergenic
1024694842 7:51845494-51845516 GAGGGTTCTGCAAGAGACCAGGG - Intergenic
1024756682 7:52541536-52541558 GGGGGCACTGCAGGAGACCCGGG + Intergenic
1024801556 7:53086041-53086063 GAGGGTACTGCAGGAGACCAAGG + Intergenic
1024891959 7:54213353-54213375 GGGGGTGCTGCAGGAGACTAGGG + Intergenic
1024946132 7:54809114-54809136 GGGGGTGCTGCAGGAGGCCAGGG - Intergenic
1025108922 7:56196427-56196449 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1025116748 7:56264754-56264776 GGGAGCGCTACGGGAGACCAGGG - Intergenic
1025246934 7:57324587-57324609 GGGGGTGCTGCAGGAGGCCAGGG - Intergenic
1025296099 7:57776236-57776258 AGGGGGCCTGCAGGAGACCCAGG - Intergenic
1025722973 7:64033145-64033167 GAGGGCACTGCAGGAGACCCGGG + Intronic
1025734757 7:64137168-64137190 GGGAGCGCTACGGGAGACCAGGG - Intronic
1025743763 7:64225005-64225027 GAGGGTACTACAGGAGACCAGGG + Intronic
1025755309 7:64332644-64332666 GAGGGTACTGCAGGAGACCAGGG + Intronic
1025870131 7:65423501-65423523 GGGGGCGCTGCAGGAGGCCAAGG - Intergenic
1026457953 7:70589306-70589328 AGTGGAGCTGCAGGAGAGCATGG + Intronic
1027291486 7:76716692-76716714 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1027342046 7:77220095-77220117 TGGGGCGCTGCAGGAGACCAGGG + Intronic
1027566596 7:79802214-79802236 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1027859090 7:83552717-83552739 GAGGGTACTGCAGGATACCAGGG - Intronic
1027976129 7:85158406-85158428 AGGAGCGCTACAGGAGACCGGGG - Intronic
1028191480 7:87858059-87858081 GAGGGTACTGCAGGAGACCAGGG - Intronic
1028331585 7:89601256-89601278 GAGCGTACTGCAGGAGACCAGGG + Intergenic
1028439122 7:90838685-90838707 GAGGGCACTGCAGGAGACCAGGG - Intronic
1028450246 7:90973972-90973994 GAGGGTACTGCAGGAGACCAGGG + Intronic
1028584902 7:92443129-92443151 GAGGGTACTGCAGAAGACCAGGG + Intergenic
1028599942 7:92590423-92590445 GGGGGCGCTGTAGCAGAGCGCGG - Intergenic
1029443938 7:100602719-100602741 TGGTGGCCTGCAGGAGACCAAGG - Intronic
1029482185 7:100819883-100819905 GGAGGGGCTGCAGGAGACCAGGG + Exonic
1029531361 7:101127392-101127414 GGGGTGACTGCAGGAGAGCAGGG + Intronic
1029736341 7:102467872-102467894 GGAGAAGCTTCAGGAGACCAAGG + Intronic
1030411230 7:109182652-109182674 GAGGGCATTGCAGGAGACCAGGG + Intergenic
1030444558 7:109633021-109633043 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1030497724 7:110320545-110320567 GAGAGTACTGCAGGAGACCAGGG - Intergenic
1031304563 7:120110315-120110337 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1031416053 7:121497692-121497714 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1031513897 7:122679339-122679361 GGGGGTGCTGCAGGAGAGTAGGG - Intronic
1031763035 7:125737939-125737961 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1031978670 7:128109905-128109927 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1031996966 7:128239317-128239339 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1032003294 7:128280560-128280582 GATGGTACTGCAGGAGACCAGGG + Intergenic
1032004706 7:128291876-128291898 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1032898030 7:136273950-136273972 GGTGGTGCTGCAGGAGAGAAGGG + Intergenic
1032937105 7:136745602-136745624 GGGAGTGCTACAGGAGACCAGGG + Intergenic
1033152161 7:138924953-138924975 GGGAGCGGTGCAGGAGTCCGGGG - Intronic
1033627383 7:143123472-143123494 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1033677085 7:143553371-143553393 GGGGGCGTTGCAGGAGACTAGGG + Intergenic
1033694750 7:143776066-143776088 GGGGGCGTTGCAGGAGACTAGGG - Intergenic
1033904963 7:146191556-146191578 GGGAGTGCTACGGGAGACCAGGG + Intronic
1034251767 7:149697962-149697984 GAGGGTGCTGCAGGAGACCGGGG - Intergenic
1034367015 7:150559948-150559970 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1034440989 7:151086154-151086176 CCGGGCGCGGGAGGAGACCAGGG + Intronic
1035342621 7:158173655-158173677 GAGGGCACTGCAGGAGACCAGGG + Intronic
1035460809 7:159037359-159037381 AGGGGCCCTGCAGGGGCCCAGGG + Intronic
1035510637 8:179570-179592 GGTGGAGCTGCCTGAGACCATGG - Intergenic
1035572847 8:685071-685093 GGGGGCGCTGCAGGAGACCAGGG + Intronic
1035642950 8:1197808-1197830 GGGAACGCTGCAGGAGGCCCAGG - Intergenic
1036118419 8:5986965-5986987 GATGGTACTGCAGGAGACCAGGG + Intergenic
1036249808 8:7152128-7152150 TTGGGTACTGCAGGAGACCAGGG - Intergenic
1036495958 8:9270098-9270120 GGGGGTGCTGCAGGAGACTAGGG + Intergenic
1036700100 8:11007792-11007814 AGGGGAGCTGCAGGAAGCCAGGG - Intronic
1036728485 8:11241334-11241356 TTGGGTACTGCAGGAGACCAGGG - Intergenic
1036997557 8:13676428-13676450 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1037063384 8:14544634-14544656 GAGGTTTCTGCAGGAGACCAGGG - Intronic
1037136943 8:15473948-15473970 GAGGGTACTGCAGGAGACCAGGG + Intronic
1037204252 8:16294848-16294870 GGGGGTGCTGCAGGAGACTAGGG - Intronic
1037312672 8:17573381-17573403 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1037337006 8:17801380-17801402 CGGCTCGCTGCGGGAGACCAAGG + Intergenic
1037818771 8:22125547-22125569 GGGGGCACTGGAGGTGTCCAGGG + Intronic
1038991886 8:32877364-32877386 GGGAGTGCTACAGGAGACCAGGG - Intergenic
1039111389 8:34043999-34044021 GGGGGCGCTGCAGGAGACTAGGG + Intergenic
1039183128 8:34888563-34888585 GAGAGTACTGCAGGAGACCAGGG + Intergenic
1039185460 8:34910756-34910778 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1039331042 8:36536842-36536864 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1039501685 8:38022619-38022641 GAAGGTACTGCAGGAGACCAGGG + Intergenic
1039669322 8:39578960-39578982 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1039691227 8:39866854-39866876 GAGGATTCTGCAGGAGACCAGGG + Intergenic
1040091622 8:43404576-43404598 GGGGGCACTGCAGGAGACGAGGG - Intergenic
1040139394 8:43893177-43893199 GGGAGTGCTGCAGGAGACTAGGG - Intergenic
1040140032 8:43898917-43898939 GGAGGTGCTGCAGGAGACTAGGG - Intergenic
1040352186 8:46580852-46580874 GAGGGCACTGCAGGAGAACAGGG - Intergenic
1040353213 8:46589281-46589303 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1040426058 8:47287460-47287482 GAGGGTACTGCAGGAGACCAGGG + Intronic
1040474724 8:47765722-47765744 GAGGGCAGTGCAGGAGACCAGGG - Intergenic
1040499440 8:47993913-47993935 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1040583779 8:48720475-48720497 AGGAGTACTGCAGGAGACCAGGG - Intronic
1040679070 8:49787213-49787235 GGGAGTGCTTCAGGAGACCAGGG + Intergenic
1040795939 8:51290118-51290140 GAGGGTACTGCAGGAGACCAAGG + Intergenic
1040840085 8:51776051-51776073 GGGAGCGCTACAGGAGACCGGGG - Intronic
1040842663 8:51801220-51801242 GAGGGTACTGCAGGAGACCAGGG - Intronic
1040926393 8:52688445-52688467 GAGGGTACTGCAGGAGACCAGGG - Intronic
1041010567 8:53538610-53538632 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1041020112 8:53630222-53630244 GGGGGCTCAGAAAGAGACCAAGG - Intergenic
1041210442 8:55545248-55545270 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
1041287486 8:56275370-56275392 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1041770940 8:61471912-61471934 GAGGGGCCTGCAGGAGGCCAGGG - Intronic
1041860139 8:62503543-62503565 GAGGGTACTGCAGGAGACCAGGG + Intronic
1041886031 8:62808916-62808938 GGGAGCGCTACGGGAGACCAGGG + Intronic
1042084470 8:65092687-65092709 GAGGGTGCTGCAGGAGACCAGGG - Intergenic
1042191940 8:66195835-66195857 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1042197718 8:66247482-66247504 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1042197823 8:66248469-66248491 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1042355604 8:67824294-67824316 TGGGGCGCTGCAGGAGACTAGGG + Intergenic
1042428872 8:68680852-68680874 GAGGGTACTGCAGGAGACCAGGG + Intronic
1042991761 8:74648296-74648318 GAGGGTACTGCAGGAGACCAGGG - Intronic
1043034044 8:75175104-75175126 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1043144959 8:76641622-76641644 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1043281353 8:78470822-78470844 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1043324427 8:79033206-79033228 GGGTGCGATGCAGGAGGCCAGGG - Intergenic
1043483814 8:80679147-80679169 GGGGGTGGTGCAGGACTCCAGGG - Intronic
1043750796 8:83931284-83931306 GAGGGTACTGCAGGATACCAGGG - Intergenic
1043909038 8:85839213-85839235 AGAGGTGCTGCAGGAGACAATGG - Intergenic
1044003453 8:86913811-86913833 GGGGGTGCTGCAGGAGACTAGGG + Intronic
1044039097 8:87342954-87342976 GAGGGTACTGCAGGAGACCAGGG + Intronic
1044086281 8:87945776-87945798 GGGGACGCTGCAGGAGACCAGGG + Intergenic
1044142289 8:88670893-88670915 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1044170350 8:89043602-89043624 GGGGGTGCTGTAGGAGACTAGGG - Intergenic
1044307810 8:90657702-90657724 GAGGGTACTGCAGGAGACCAGGG + Intronic
1044318635 8:90777503-90777525 GAGGGTACTGCAGGAGACCAGGG + Intronic
1044738126 8:95299833-95299855 GGGGGTGAGGCAGGAGAACAGGG + Intergenic
1045189846 8:99871796-99871818 GGAGTGGCTGCTGGAGACCAAGG + Intronic
1045407336 8:101880052-101880074 TGGGGCCTTGCAGGAGCCCATGG + Intronic
1045593531 8:103627048-103627070 GAGGGTACTGCAGGAGACCAGGG + Intronic
1045729268 8:105216499-105216521 GAGGGCACTGCAGGAGACAAGGG - Intronic
1045813978 8:106258115-106258137 GAGGGTGCTGCAGGAGACCAGGG - Intergenic
1045954357 8:107889553-107889575 GGGGGTGATGCAGGAGACTAGGG + Intergenic
1046044025 8:108942548-108942570 GGGGGCACTGCAGGGGACCAGGG - Intergenic
1046187856 8:110746537-110746559 GGGGGTGCTGCAGGAGACTAGGG - Intergenic
1046191327 8:110798703-110798725 GGGGGCGCTGCAGGAGACTAGGG + Intergenic
1046253570 8:111666296-111666318 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1046282581 8:112053229-112053251 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1046342662 8:112879292-112879314 GGGGGCACTGCAGGAGACTAGGG - Intronic
1046494561 8:114996866-114996888 GAGGGTACCGCAGGAGACCAGGG - Intergenic
1047292389 8:123541511-123541533 CCGGGAGCTGCAGGAGACCGGGG - Intergenic
1047441148 8:124879808-124879830 GAGGGCCCTGCAGGAGCTCAGGG + Intergenic
1047661935 8:127046871-127046893 GAGGGTACTGCAGGATACCAGGG - Intergenic
1048033790 8:130657650-130657672 GAGGGTTGTGCAGGAGACCAGGG + Intergenic
1048239200 8:132724277-132724299 GAGGGTACTGCAGGAGACCAGGG + Intronic
1048602169 8:135930071-135930093 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1048670336 8:136712246-136712268 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1049224713 8:141444711-141444733 GGGGGCGGCACAGGACACCATGG - Intergenic
1049437759 8:142595575-142595597 GGTGGGGGTGCAGGAGGCCAGGG - Intergenic
1050255679 9:3789733-3789755 GGTGGAGCTGCACAAGACCATGG + Intergenic
1050394483 9:5180597-5180619 GAGGGTACTGCAGGAGACCAGGG - Intronic
1050606708 9:7309298-7309320 GGGAGTGCTACAGGAGACCAGGG - Intergenic
1051375102 9:16394534-16394556 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1051658281 9:19403450-19403472 GAGGGTACTGCAGGAGATCAGGG - Intergenic
1052061092 9:23962278-23962300 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1052125921 9:24774376-24774398 GAGGGTGCTGCAGGAGACCAGGG + Intergenic
1052456064 9:28699824-28699846 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1052687144 9:31771182-31771204 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1052741033 9:32393346-32393368 GGGAGCGCTACAGGAGACTGGGG - Intronic
1052777204 9:32743838-32743860 GAGGGCGCTGCAGGAAACCAGGG + Intergenic
1053077920 9:35150788-35150810 TGGGCAGCTGCAGCAGACCAGGG - Intergenic
1053087592 9:35239634-35239656 GGGAGCACTACAGGAGACCAGGG + Intronic
1053652603 9:40184270-40184292 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1053903005 9:42813577-42813599 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1054531979 9:66191951-66191973 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1055348678 9:75362613-75362635 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1055622606 9:78142252-78142274 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
1056082726 9:83113690-83113712 GAGGCTACTGCAGGAGACCAGGG - Intergenic
1056082845 9:83114692-83114714 GGGAGTGCTACAGGAGACCGGGG - Intergenic
1056176542 9:84042058-84042080 GGGAGCGCTACAGGAGACTGGGG - Intergenic
1057100599 9:92355192-92355214 GAGGGTACTGCAGGAGACCAGGG + Intronic
1057370918 9:94472214-94472236 GGGGGTGCTACAGGAGACCGGGG + Intergenic
1057822437 9:98342806-98342828 GGGGGAAGTGCTGGAGACCAGGG - Intronic
1058137922 9:101327791-101327813 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1058143666 9:101385341-101385363 GAGGGTACCGCAGGAGACCAGGG + Intergenic
1058225457 9:102356205-102356227 GAGGGTACTGCAGGAGGCCAGGG - Intergenic
1058252208 9:102713155-102713177 GAGGGTACTACAGGAGACCAGGG - Intergenic
1058253264 9:102729125-102729147 GGGGGCACTGCAGGAGGCCAGGG + Intergenic
1058467626 9:105244867-105244889 GGCGGAGCTGCAGCAGCCCATGG - Exonic
1058533758 9:105933568-105933590 GAGGGTTCTGCAGGAGACCAGGG - Intergenic
1058542868 9:106030280-106030302 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1059094877 9:111401611-111401633 GAGGGCACTGCAGGAGACCAGGG + Intronic
1059105941 9:111511710-111511732 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1059112225 9:111568352-111568374 GAGGGTACTGCAGGAGATCAGGG - Intronic
1059523175 9:114962998-114963020 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1059580892 9:115547143-115547165 GAGGGTACTGCAGGAGACCATGG + Intergenic
1060015822 9:120085367-120085389 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1060305344 9:122406270-122406292 TGGGGCGGCGCAGGAGCCCACGG + Intergenic
1060756880 9:126220011-126220033 GGGGACGCTGCAGATGGCCAAGG + Intergenic
1060968161 9:127723103-127723125 GGTGGGGCTGCAGGAGGCCATGG - Exonic
1061052603 9:128205103-128205125 GGGGGCTCTGCAGGAGCCATTGG - Intronic
1061084811 9:128392721-128392743 GGGAACCCCGCAGGAGACCAGGG - Intergenic
1061304497 9:129724580-129724602 GGGGGTGCTGCAGGGGCCCAGGG + Intergenic
1061406225 9:130394369-130394391 GGGGGCTCTGCAAGCCACCATGG - Intronic
1061532897 9:131228773-131228795 TGGGGGGCTGCAGGGGAGCAGGG - Intronic
1061898807 9:133662535-133662557 GGGGCTGCGGCTGGAGACCAGGG - Intergenic
1062093106 9:134688916-134688938 CAGGGCTCTGAAGGAGACCAGGG - Intronic
1062187551 9:135226841-135226863 GGGGGCTCTGGTGGGGACCAGGG - Intergenic
1062192692 9:135255968-135255990 GCGGGCACTGCAAGAGGCCAGGG - Intergenic
1062208274 9:135349098-135349120 GGGGTCTCTGGAGGAGCCCAAGG + Intergenic
1062444337 9:136587402-136587424 GTGGGGGGTGCTGGAGACCAGGG + Intergenic
1062482507 9:136759162-136759184 GGGGGAGCTGCAGGAGGCCGGGG - Intergenic
1062728322 9:138092251-138092273 GAGGGCACTGCAGGAGACCAGGG + Intronic
1062757285 9:138307046-138307068 GGTGGAGCTGCCTGAGACCATGG + Intergenic
1203517729 Un_GL000213v1:18730-18752 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1203525861 Un_GL000213v1:85994-86016 GGGACAGCAGCAGGAGACCAGGG - Intergenic
1203757085 Un_GL000218v1:141934-141956 AGGGGCCCTCCAGGAGACCTAGG - Intergenic
1203486889 Un_GL000224v1:64408-64430 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1203499510 Un_KI270741v1:6308-6330 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1185623185 X:1465803-1465825 GGGGGCGAAGCAGGTGACAAAGG + Exonic
1185966698 X:4613924-4613946 GAGAGTACTGCAGGAGACCAGGG + Intergenic
1186568698 X:10691962-10691984 GAGGGTACTGCAGGAGACCAGGG - Intronic
1186598197 X:11007279-11007301 GGGGGCGCTGCACGAGACTAGGG - Intergenic
1186857159 X:13637383-13637405 GACGGTACTGCAGGAGACCAGGG + Intergenic
1186994540 X:15105927-15105949 GGGGGCGCTGCAGGAGGCCAGGG + Intergenic
1187002725 X:15199415-15199437 GGTGGAGCTGCACAAGACCATGG - Intergenic
1187685136 X:21808400-21808422 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1188186049 X:27115887-27115909 GAGGGCATTGCAGGAGACCAAGG - Intergenic
1188255765 X:27960626-27960648 GGGGGCACTACAGGAGACCAGGG - Intergenic
1188256299 X:27965535-27965557 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1188425039 X:30036650-30036672 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1188435013 X:30149420-30149442 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1188446224 X:30255852-30255874 GGGGGCACTGCAGGAGGCCAGGG + Intergenic
1188752993 X:33926437-33926459 GGAGGTGCTGCAGGAGACCAGGG - Intergenic
1188776527 X:34226611-34226633 GGGGCCACTGCAGGAGGCCAGGG + Intergenic
1189310005 X:40012363-40012385 AAGGGCGCTCCAGGCGACCAGGG + Intergenic
1189557605 X:42161786-42161808 GGGAGCGCTGCGGGAGACCAGGG + Intergenic
1190152789 X:47962186-47962208 AGGGGCACTGCAGGAGGCCAGGG + Intronic
1190185905 X:48234069-48234091 GGGAGTGCTGTGGGAGACCAGGG - Intronic
1190651369 X:52571943-52571965 GGGAGCGCTACAGGAGACTGGGG - Intergenic
1191147531 X:57183991-57184013 GAGGGTACTGAAGGAGACCAGGG - Intergenic
1191191628 X:57674348-57674370 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1191654523 X:63581604-63581626 GGGGGCACTGCAGGAGACTAGGG + Intergenic
1191721996 X:64238886-64238908 GGGGGCGCTGCAGGAGGCCAGGG + Intergenic
1191814790 X:65231449-65231471 GAGGGTACTTCAGGAGACCAGGG + Intergenic
1192675588 X:73192536-73192558 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1192753922 X:74025331-74025353 GGGGGTGCTGCAGGAGACCAGGG + Intergenic
1192842496 X:74871532-74871554 GAGGGCACTGCAGGAGACCAGGG + Intronic
1192930783 X:75803641-75803663 GAGGGCACGGCAGGAGACCAGGG + Intergenic
1193044429 X:77036374-77036396 GAGGGTTCTGCAGGAGACCAGGG + Intergenic
1193224733 X:78969078-78969100 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1193262416 X:79424505-79424527 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1193441392 X:81543857-81543879 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1193540644 X:82767489-82767511 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1193561960 X:83029657-83029679 GAGGATGCTGCAGGAGACCAGGG + Intergenic
1193708420 X:84851403-84851425 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1193712084 X:84893046-84893068 GAGGGTGCTGCAGGAGACCAGGG - Intergenic
1193872961 X:86824125-86824147 GAGGGTACTACAGGAGACCAGGG + Intronic
1193980288 X:88174318-88174340 GAGGGTAATGCAGGAGACCAGGG + Intergenic
1193994239 X:88345054-88345076 GGGAGCCCTACAGGAGACCAGGG + Intergenic
1194042267 X:88956298-88956320 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1194071102 X:89327481-89327503 GAGGTTACTGCAGGAGACCAGGG - Intergenic
1194378855 X:93168878-93168900 GGGGGCACTACAGGAGACAGGGG - Intergenic
1194440645 X:93929265-93929287 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1194923262 X:99793943-99793965 GGGAGCGCTACAGGAGACTGGGG - Intergenic
1195128820 X:101835394-101835416 GAAGGTACTGCAGGAGACCAGGG + Intronic
1195258318 X:103109664-103109686 CAGGGTACTGCAGGAGACCAGGG + Intergenic
1195556748 X:106235624-106235646 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1195823613 X:108973090-108973112 GGCGGCGCTGCCCAAGACCATGG + Intergenic
1195838322 X:109144269-109144291 GGGGGTGCTGCAGGAGACTAGGG - Intergenic
1195981434 X:110582483-110582505 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1195999364 X:110764855-110764877 GAGGGTACTGCAGGAGACCAGGG - Intronic
1196271771 X:113720461-113720483 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1196311151 X:114167423-114167445 GGGGGCACTGCAGGAGACCAGGG + Intergenic
1196425420 X:115563659-115563681 GAGGCTGCTGCAGGAGACAAAGG - Intronic
1196541798 X:116919039-116919061 GAGGGTACTGCAGGAGAACAGGG - Intergenic
1196637069 X:118014351-118014373 GAAGGCACTGCAGGAGACCAGGG - Intronic
1196713458 X:118787579-118787601 GAGGGTGCTGCAGGAGACTAGGG + Intronic
1196944246 X:120808470-120808492 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1197041376 X:121939888-121939910 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1197071664 X:122306270-122306292 GGGAGCGCTACAGGAGACCAGGG - Intergenic
1197358452 X:125467215-125467237 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1197375403 X:125676535-125676557 GAGGGCACTGCAGGAGACCAGGG - Intergenic
1197520653 X:127492138-127492160 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1197542072 X:127776451-127776473 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1197549176 X:127867058-127867080 GAGGGCGCTGCAGGAGACCAGGG - Intergenic
1197557036 X:127968416-127968438 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1197628618 X:128832299-128832321 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1197720891 X:129743863-129743885 GGGGGCTCTTCTGGAGGCCAGGG + Intronic
1197795333 X:130291918-130291940 GAGGGCACTGCAGGAGACCAGGG + Intergenic
1197817461 X:130512870-130512892 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1198556469 X:137798712-137798734 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1198594330 X:138219866-138219888 GGGGACCCTCCAGGAAACCATGG - Intergenic
1198994716 X:142561172-142561194 GGGGGCGCTGCAGGAGGCCAGGG - Intergenic
1198996492 X:142579212-142579234 GAGGGTATTGCAGGAGACCAGGG - Intergenic
1199107666 X:143890040-143890062 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1199339679 X:146662075-146662097 GGGGGTGCTGCAGGAAAGCAGGG - Intergenic
1199360779 X:146915823-146915845 GGGGGTGCTGCAGGAGACTAGGG + Intergenic
1199364071 X:146957746-146957768 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1199374971 X:147097623-147097645 GGGAGCACTACAGGAGACCAGGG - Intergenic
1199512857 X:148642159-148642181 CGGGGCTCTGCAGGAGTGCATGG + Intronic
1199765965 X:150941909-150941931 GGGGCCCCTGGAGGAGACCTGGG + Intergenic
1199989357 X:152976741-152976763 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1200021290 X:153211973-153211995 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1200141807 X:153906240-153906262 GGGGGCGCCGCAGGGGACGCCGG + Exonic
1200299235 X:154955947-154955969 GGGGGCACTGCAGGAGACCAGGG + Intronic
1200372382 X:155740559-155740581 GAGGGTACTGCAGGAGACCAGGG - Intergenic
1200393125 X:155964367-155964389 GAGGGTACTGCAGGAAACCAGGG + Intergenic
1200725331 Y:6663226-6663248 GAGGTTACTGCAGGAGACCAGGG - Intergenic
1200770030 Y:7116044-7116066 CAGGGCACTACAGGAGACCAGGG + Intergenic
1200878375 Y:8184100-8184122 TGGGGCACTGCAGGAGACTAGGG + Intergenic
1201343015 Y:12954205-12954227 GGGGGCGCTGCAGGAGGCTAGGG + Intergenic
1201475975 Y:14380874-14380896 GAGGGTACTGCAGGAGACCAAGG + Intergenic
1201616749 Y:15908950-15908972 GAGGGTACTGCAGGAGACCAGGG + Intergenic
1201792627 Y:17858973-17858995 GGGCTTGCTGCAGGAGGCCAGGG - Intergenic
1201808927 Y:18047013-18047035 GGGCTTGCTGCAGGAGGCCAGGG + Intergenic
1201860437 Y:18591934-18591956 GAGGTTGCTGCAGGAGACCAGGG - Intergenic
1201872886 Y:18728447-18728469 GAGGTTGCTGCAGGAGACCAGGG + Intergenic
1201967941 Y:19758749-19758771 GGGGGTACTGCAGGATACCAGGG - Intergenic
1202255184 Y:22913541-22913563 GGGGATGCTGCTGGAGACTAGGG + Intergenic
1202354162 Y:24028220-24028242 GGGGTTGCTGCAGGAGGCCAGGG - Intergenic
1202372895 Y:24210326-24210348 CTGGGCCCTGCAGGAGGCCATGG - Intergenic
1202408175 Y:24547290-24547312 GGGGATGCTGCTGGAGACTAGGG + Intergenic
1202462607 Y:25122790-25122812 GGGGATGCTGCTGGAGACTAGGG - Intergenic
1202497887 Y:25459794-25459816 CTGGGCCCTGCAGGAGGCCATGG + Intergenic
1202516617 Y:25641892-25641914 GGGGTTGCTGCAGGAGGCCAGGG + Intergenic