ID: 939150938

View in Genome Browser
Species Human (GRCh38)
Location 2:138472133-138472155
Sequence AGCCACTAACTGGTACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939150934_939150938 25 Left 939150934 2:138472085-138472107 CCCTCGATGCTTATTTTAATGCT No data
Right 939150938 2:138472133-138472155 AGCCACTAACTGGTACTTACTGG No data
939150935_939150938 24 Left 939150935 2:138472086-138472108 CCTCGATGCTTATTTTAATGCTA No data
Right 939150938 2:138472133-138472155 AGCCACTAACTGGTACTTACTGG No data
939150933_939150938 26 Left 939150933 2:138472084-138472106 CCCCTCGATGCTTATTTTAATGC No data
Right 939150938 2:138472133-138472155 AGCCACTAACTGGTACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939150938 Original CRISPR AGCCACTAACTGGTACTTAC TGG Intergenic
No off target data available for this crispr