ID: 939153030

View in Genome Browser
Species Human (GRCh38)
Location 2:138495324-138495346
Sequence AACCCTGGATATTCTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153030_939153037 23 Left 939153030 2:138495324-138495346 CCTCTGAAAGAATATCCAGGGTT No data
Right 939153037 2:138495370-138495392 TCTTCTGCTTGGCATAGTTCAGG No data
939153030_939153039 28 Left 939153030 2:138495324-138495346 CCTCTGAAAGAATATCCAGGGTT No data
Right 939153039 2:138495375-138495397 TGCTTGGCATAGTTCAGGCAGGG No data
939153030_939153038 27 Left 939153030 2:138495324-138495346 CCTCTGAAAGAATATCCAGGGTT No data
Right 939153038 2:138495374-138495396 CTGCTTGGCATAGTTCAGGCAGG No data
939153030_939153035 12 Left 939153030 2:138495324-138495346 CCTCTGAAAGAATATCCAGGGTT No data
Right 939153035 2:138495359-138495381 GAATTCGCCTTTCTTCTGCTTGG No data
939153030_939153040 29 Left 939153030 2:138495324-138495346 CCTCTGAAAGAATATCCAGGGTT No data
Right 939153040 2:138495376-138495398 GCTTGGCATAGTTCAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153030 Original CRISPR AACCCTGGATATTCTTTCAG AGG (reversed) Intergenic
No off target data available for this crispr