ID: 939153032

View in Genome Browser
Species Human (GRCh38)
Location 2:138495339-138495361
Sequence TTCAAGGGTTACCTAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153032_939153037 8 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153037 2:138495370-138495392 TCTTCTGCTTGGCATAGTTCAGG No data
939153032_939153038 12 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153038 2:138495374-138495396 CTGCTTGGCATAGTTCAGGCAGG No data
939153032_939153040 14 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153040 2:138495376-138495398 GCTTGGCATAGTTCAGGCAGGGG No data
939153032_939153041 17 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG No data
939153032_939153039 13 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153039 2:138495375-138495397 TGCTTGGCATAGTTCAGGCAGGG No data
939153032_939153035 -3 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153035 2:138495359-138495381 GAATTCGCCTTTCTTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153032 Original CRISPR TTCAAGGGTTACCTAAACCC TGG (reversed) Intergenic
No off target data available for this crispr