ID: 939153033

View in Genome Browser
Species Human (GRCh38)
Location 2:138495354-138495376
Sequence CAGAAGAAAGGCGAATTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153033_939153040 -1 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153040 2:138495376-138495398 GCTTGGCATAGTTCAGGCAGGGG No data
939153033_939153041 2 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG No data
939153033_939153043 28 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153043 2:138495405-138495427 AATGTGTTAAGACTTCAGCAAGG No data
939153033_939153038 -3 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153038 2:138495374-138495396 CTGCTTGGCATAGTTCAGGCAGG No data
939153033_939153037 -7 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153037 2:138495370-138495392 TCTTCTGCTTGGCATAGTTCAGG No data
939153033_939153039 -2 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153039 2:138495375-138495397 TGCTTGGCATAGTTCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153033 Original CRISPR CAGAAGAAAGGCGAATTCAA GGG (reversed) Intergenic