ID: 939153035

View in Genome Browser
Species Human (GRCh38)
Location 2:138495359-138495381
Sequence GAATTCGCCTTTCTTCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153030_939153035 12 Left 939153030 2:138495324-138495346 CCTCTGAAAGAATATCCAGGGTT No data
Right 939153035 2:138495359-138495381 GAATTCGCCTTTCTTCTGCTTGG No data
939153032_939153035 -3 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153035 2:138495359-138495381 GAATTCGCCTTTCTTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153035 Original CRISPR GAATTCGCCTTTCTTCTGCT TGG Intergenic
No off target data available for this crispr