ID: 939153035 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:138495359-138495381 |
Sequence | GAATTCGCCTTTCTTCTGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
939153030_939153035 | 12 | Left | 939153030 | 2:138495324-138495346 | CCTCTGAAAGAATATCCAGGGTT | No data | ||
Right | 939153035 | 2:138495359-138495381 | GAATTCGCCTTTCTTCTGCTTGG | No data | ||||
939153032_939153035 | -3 | Left | 939153032 | 2:138495339-138495361 | CCAGGGTTTAGGTAACCCTTGAA | No data | ||
Right | 939153035 | 2:138495359-138495381 | GAATTCGCCTTTCTTCTGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
939153035 | Original CRISPR | GAATTCGCCTTTCTTCTGCT TGG | Intergenic | ||