ID: 939153036

View in Genome Browser
Species Human (GRCh38)
Location 2:138495366-138495388
Sequence AACTATGCCAAGCAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153036_939153043 16 Left 939153036 2:138495366-138495388 CCTTTCTTCTGCTTGGCATAGTT No data
Right 939153043 2:138495405-138495427 AATGTGTTAAGACTTCAGCAAGG No data
939153036_939153041 -10 Left 939153036 2:138495366-138495388 CCTTTCTTCTGCTTGGCATAGTT No data
Right 939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG No data
939153036_939153045 21 Left 939153036 2:138495366-138495388 CCTTTCTTCTGCTTGGCATAGTT No data
Right 939153045 2:138495410-138495432 GTTAAGACTTCAGCAAGGTTGGG No data
939153036_939153044 20 Left 939153036 2:138495366-138495388 CCTTTCTTCTGCTTGGCATAGTT No data
Right 939153044 2:138495409-138495431 TGTTAAGACTTCAGCAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153036 Original CRISPR AACTATGCCAAGCAGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr