ID: 939153038

View in Genome Browser
Species Human (GRCh38)
Location 2:138495374-138495396
Sequence CTGCTTGGCATAGTTCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153032_939153038 12 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153038 2:138495374-138495396 CTGCTTGGCATAGTTCAGGCAGG No data
939153030_939153038 27 Left 939153030 2:138495324-138495346 CCTCTGAAAGAATATCCAGGGTT No data
Right 939153038 2:138495374-138495396 CTGCTTGGCATAGTTCAGGCAGG No data
939153033_939153038 -3 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153038 2:138495374-138495396 CTGCTTGGCATAGTTCAGGCAGG No data
939153034_939153038 -4 Left 939153034 2:138495355-138495377 CCTTGAATTCGCCTTTCTTCTGC No data
Right 939153038 2:138495374-138495396 CTGCTTGGCATAGTTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153038 Original CRISPR CTGCTTGGCATAGTTCAGGC AGG Intergenic
No off target data available for this crispr