ID: 939153041

View in Genome Browser
Species Human (GRCh38)
Location 2:138495379-138495401
Sequence TGGCATAGTTCAGGCAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153033_939153041 2 Left 939153033 2:138495354-138495376 CCCTTGAATTCGCCTTTCTTCTG No data
Right 939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG No data
939153036_939153041 -10 Left 939153036 2:138495366-138495388 CCTTTCTTCTGCTTGGCATAGTT No data
Right 939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG No data
939153034_939153041 1 Left 939153034 2:138495355-138495377 CCTTGAATTCGCCTTTCTTCTGC No data
Right 939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG No data
939153032_939153041 17 Left 939153032 2:138495339-138495361 CCAGGGTTTAGGTAACCCTTGAA No data
Right 939153041 2:138495379-138495401 TGGCATAGTTCAGGCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153041 Original CRISPR TGGCATAGTTCAGGCAGGGG AGG Intergenic
No off target data available for this crispr