ID: 939153966

View in Genome Browser
Species Human (GRCh38)
Location 2:138502261-138502283
Sequence CGGCGAGCTCCGGCCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939153956_939153966 11 Left 939153956 2:138502227-138502249 CCTCTGCTCTCTGGGTCCCGGAC 0: 1
1: 0
2: 0
3: 23
4: 237
Right 939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 98
939153955_939153966 12 Left 939153955 2:138502226-138502248 CCCTCTGCTCTCTGGGTCCCGGA 0: 1
1: 0
2: 1
3: 26
4: 339
Right 939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 98
939153951_939153966 22 Left 939153951 2:138502216-138502238 CCTCACTGCGCCCTCTGCTCTCT 0: 1
1: 0
2: 3
3: 54
4: 519
Right 939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 98
939153961_939153966 -6 Left 939153961 2:138502244-138502266 CCGGACCCCTGCTCGGGCGGCGA 0: 1
1: 0
2: 0
3: 7
4: 50
Right 939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 98
939153960_939153966 -5 Left 939153960 2:138502243-138502265 CCCGGACCCCTGCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 7
4: 139
Right 939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939153966 Original CRISPR CGGCGAGCTCCGGCCTGCTC TGG Intronic
913130993 1:115838498-115838520 CGTCGCGCGCCGGCCTGCTGTGG - Exonic
913237441 1:116797027-116797049 CTGAGAGCTCCTGCCAGCTCAGG - Intergenic
917632410 1:176903385-176903407 CAGCGAGGTCCGGGCTCCTCTGG - Intronic
920536055 1:206737273-206737295 CGGGTAGGTCGGGCCTGCTCAGG + Intergenic
921039580 1:211416789-211416811 GGCTGAGCTCCGTCCTGCTCAGG + Intergenic
924738461 1:246780217-246780239 AGGAGAACTCAGGCCTGCTCTGG + Intergenic
924739899 1:246789000-246789022 CAGCGGGCTCCGGCCTGGCCAGG + Intergenic
1062847253 10:717667-717689 CGGTGAGGTGAGGCCTGCTCAGG - Intergenic
1069947813 10:71999669-71999691 CGGCCTGTTCCGGCCTCCTCCGG - Intronic
1072003535 10:91220694-91220716 CGGCGCGCTCCCGCCTGCAGGGG + Intronic
1072141325 10:92591663-92591685 CGGTCACCTCCGGCCTGCTGCGG - Intergenic
1075515369 10:123104112-123104134 CGGGGAGCTCCGGGCAGCTGCGG + Intergenic
1075522239 10:123149820-123149842 AGGCGCGCTCCGAGCTGCTCAGG - Exonic
1077251592 11:1563199-1563221 AGGCCAGCTCCGTCCGGCTCTGG + Intronic
1077361862 11:2144392-2144414 TGGCCACCTCCGGCCTGCCCCGG + Intronic
1077413549 11:2414345-2414367 CTGCCCCCTCCGGCCTGCTCCGG + Intronic
1080026645 11:27622168-27622190 CTGCGAGCCCCGGCCAACTCTGG + Intergenic
1085396832 11:76210631-76210653 TGGCAAGCTGCGGCCGGCTCAGG + Intronic
1088823554 11:113475514-113475536 CGGCGATCCCCGGCCTGAACGGG + Intronic
1092524403 12:9301050-9301072 AGGGGAGCCCCGCCCTGCTCAGG + Intergenic
1092542860 12:9430762-9430784 AGGGGAGCCCCGCCCTGCTCAGG - Intergenic
1094510155 12:31091675-31091697 AGGGGAGCCCCGCCCTGCTCAGG + Intronic
1095938036 12:47705951-47705973 CGGCGGGTTACGGCCTGGTCAGG - Exonic
1096773995 12:53953181-53953203 CTGCGAGCTTCGAACTGCTCCGG + Intergenic
1103927872 12:124433718-124433740 CGGGCAGCTCCGGCCTGGCCTGG + Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1113546246 13:111153530-111153552 CGGCGAGCTGCCACCTCCTCTGG - Intronic
1119106824 14:71932619-71932641 CGGCGCGCTCCGGGCTGGCCTGG - Exonic
1121931754 14:97978579-97978601 CTGCCAGCTCCGGGCTGCACAGG - Intergenic
1122558425 14:102593388-102593410 CGGCGGGCTCCCGCCCCCTCGGG - Intronic
1122786598 14:104166984-104167006 CGGCGCCCCCCTGCCTGCTCAGG + Exonic
1125532098 15:40420311-40420333 GAGCCAACTCCGGCCTGCTCGGG - Intronic
1128743227 15:70097187-70097209 GGGCGAGCTCGGGCCCCCTCCGG + Exonic
1132779429 16:1614487-1614509 CGGCGGGCTCGGGCGGGCTCGGG + Intronic
1132848125 16:2009972-2009994 CGGCCAGCCCCGGGCTCCTCTGG + Intronic
1138193248 16:55033694-55033716 CGGGGAGCGCCTGCCGGCTCCGG + Intergenic
1141266464 16:82502260-82502282 CTGGGAGCTCAGGCCTGCTCTGG - Intergenic
1141481984 16:84312998-84313020 CGGCGGGCAGCGGTCTGCTCGGG - Exonic
1141836944 16:86547010-86547032 CAGAGAGCTCCAGCCTGCTGGGG - Intronic
1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG + Intergenic
1144828812 17:18120845-18120867 CGGCGCTCTCGGGCCTGCCCCGG + Exonic
1146053163 17:29568082-29568104 CGGCTAGCTCCGGCCTCCCGGGG + Intronic
1153225143 18:2894187-2894209 AGGCGAGCTCTGGCTTGGTCAGG + Intronic
1158906484 18:62018177-62018199 GGGCTGGCTCCGGCCTGCCCTGG + Intergenic
1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG + Intergenic
1160164321 18:76496232-76496254 CGGGGAGCTGCGGCCTGCGGAGG + Intronic
1160597752 18:79988773-79988795 CGGCGAGCCCGGGGCTTCTCAGG - Intronic
1161013263 19:1970214-1970236 CGGCGTGGCCTGGCCTGCTCTGG - Intronic
1161576651 19:5058238-5058260 CGGAGTGCTCATGCCTGCTCAGG + Intronic
1162046783 19:8005430-8005452 AGGCGAGCTCAGGCCTGCCGCGG + Intronic
1165080207 19:33302449-33302471 CGGCGGCCTCCAGCCTGCGCGGG + Exonic
1167649067 19:50719669-50719691 CGGCTCGGTCCGGCCGGCTCCGG + Intergenic
931566812 2:63622901-63622923 CGCCGAGCCCCGGCCTGGCCCGG - Intronic
932238847 2:70142113-70142135 CGGTCAGCTCCGGCCAGGTCGGG - Intergenic
932432556 2:71684709-71684731 CGGCCGGCCCCGGCCTGCTGAGG + Intronic
934978731 2:98823246-98823268 CGGCGAGCTCCGGGGTGGCCGGG + Exonic
936251414 2:110870924-110870946 GGGAGAGGTCAGGCCTGCTCAGG + Intronic
939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG + Intronic
940083279 2:149828970-149828992 CGATTAGCTCAGGCCTGCTCAGG - Intergenic
941819218 2:169827857-169827879 CGGCGCTCTGCGGCCTGGTCTGG + Exonic
948261619 2:236608046-236608068 CGGCGTGCTCCAGCCTCCTGGGG + Intergenic
948305740 2:236945569-236945591 AGGGGAGCTCCAGCCTGCCCAGG + Intergenic
1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG + Intronic
1172118581 20:32585067-32585089 CGGCGCGCTCTGTCCTGCTCGGG + Intronic
1173007425 20:39150978-39151000 GGGCCAGCTGCGGCCAGCTCTGG + Intergenic
1173427700 20:42957132-42957154 TGGGGAGTTCCGGCATGCTCAGG - Intronic
1174346848 20:49936558-49936580 CGGCGAGCCCGGGCCTGGTCGGG + Intronic
1179176668 21:39012552-39012574 CGGTGAGCTCCGGGCTTCTGAGG - Intergenic
1179885821 21:44313884-44313906 GAGCGAGCGCCTGCCTGCTCAGG - Intronic
1183742711 22:39677677-39677699 CGCTGAGCTCCGCCCTGCACCGG + Intronic
1185330759 22:50251153-50251175 CGGCGGGCACCGGCCTGGGCGGG + Exonic
950374220 3:12557027-12557049 CGGCGTGCGCCGGCGTGCGCCGG + Exonic
954717976 3:52536359-52536381 CTGCGAGCTCAGACCTGCACTGG + Intronic
961028772 3:123584667-123584689 CCGCGAGCTCCCTCCTGCGCTGG - Intronic
961684234 3:128618239-128618261 CGCCGAGCTCTGGCCTGAGCCGG - Intergenic
966466315 3:180234141-180234163 CGGAGACCTCTGGCATGCTCTGG + Intergenic
966831913 3:184017481-184017503 CAGCCCGCTCCGGCCTGCCCAGG + Intronic
968591124 4:1460150-1460172 CAGCCAGCCCCGCCCTGCTCTGG + Intergenic
968653120 4:1767733-1767755 CGGGGGGCTCCGGCCGGCGCGGG - Intergenic
969715916 4:8868037-8868059 CGGCGCGCTCGGCGCTGCTCAGG + Exonic
981890251 4:149727877-149727899 CAGCAAGCTCAGACCTGCTCAGG + Intergenic
990210892 5:53480655-53480677 CGGCGAGCGCGGGGCTGCGCCGG + Exonic
990982874 5:61617311-61617333 CAGCTAGCTCCAGGCTGCTCTGG + Intergenic
998148235 5:139742551-139742573 CCCCGAGCTTCAGCCTGCTCAGG + Intergenic
999295681 5:150458272-150458294 CGGAGGGCTCTGGCTTGCTCAGG + Intergenic
1001146984 5:169193483-169193505 TGGTGAGCTTCGGCGTGCTCTGG + Exonic
1005608082 6:27495567-27495589 CAGCGAGCGCCTGCCTGCCCCGG - Intergenic
1007137900 6:39540609-39540631 GGGCGAGCACGCGCCTGCTCGGG + Intronic
1008644513 6:53500294-53500316 CAGCGAGCTCCGTGCTGTTCTGG + Exonic
1013106210 6:107028405-107028427 CCGCGAGCTCAGGGCTGCGCAGG + Exonic
1019473105 7:1231611-1231633 AGGAGAGCTCCGGCCTGGGCTGG - Intergenic
1020107808 7:5430231-5430253 CGGCGTGCACAGGCCTGCCCCGG - Intergenic
1024250345 7:47501490-47501512 CAGCCAGCTCCGCTCTGCTCAGG - Intronic
1031696008 7:124855244-124855266 CTTTGAGCTCCTGCCTGCTCTGG - Intronic
1034223039 7:149460299-149460321 CGTCGGGCCCCGGCCTGCTCGGG + Intronic
1039451898 8:37681843-37681865 CGCCGAGCTCAGGCCTGGGCAGG - Intergenic
1049605680 8:143528182-143528204 CTGCGTGCTCCTGCCTCCTCGGG + Intronic
1053145171 9:35707124-35707146 CGGCCAGCACCGACCAGCTCGGG + Exonic
1061724490 9:132574491-132574513 TGGCGTGCTACCGCCTGCTCAGG - Intergenic
1061870568 9:133518120-133518142 GGGTGAGCTCCCTCCTGCTCTGG + Intronic
1190246810 X:48696374-48696396 CTGGGAGCCCCGGCCTGCTTGGG + Intronic
1190258899 X:48785987-48786009 ACGCCAGCTCCGGCCTGCCCTGG - Intergenic
1198051671 X:132957591-132957613 CGGGGAGCTCCGGAGAGCTCTGG - Intronic
1199500331 X:148500501-148500523 CGGCGAGCCCCTGCCAGATCCGG + Intergenic