ID: 939158411

View in Genome Browser
Species Human (GRCh38)
Location 2:138554606-138554628
Sequence AAGTAGCCAGAGATAGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939158410_939158411 -10 Left 939158410 2:138554593-138554615 CCTACAGTGGTTAAAGTAGCCAG No data
Right 939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG No data
939158406_939158411 28 Left 939158406 2:138554555-138554577 CCCTTTTTGCACAAAGCGTAACT No data
Right 939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG No data
939158407_939158411 27 Left 939158407 2:138554556-138554578 CCTTTTTGCACAAAGCGTAACTT No data
Right 939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG No data
939158409_939158411 -9 Left 939158409 2:138554592-138554614 CCCTACAGTGGTTAAAGTAGCCA No data
Right 939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939158411 Original CRISPR AAGTAGCCAGAGATAGAGAT TGG Intronic
No off target data available for this crispr