ID: 939163943

View in Genome Browser
Species Human (GRCh38)
Location 2:138620308-138620330
Sequence CAGTTTTATTTTTCTGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939163943_939163948 11 Left 939163943 2:138620308-138620330 CCTCAACCAGAAAAATAAAACTG No data
Right 939163948 2:138620342-138620364 AAGAGGCAAGAGGGCCAAGCCGG No data
939163943_939163946 1 Left 939163943 2:138620308-138620330 CCTCAACCAGAAAAATAAAACTG No data
Right 939163946 2:138620332-138620354 TCTGAATGAAAAGAGGCAAGAGG No data
939163943_939163947 2 Left 939163943 2:138620308-138620330 CCTCAACCAGAAAAATAAAACTG No data
Right 939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG No data
939163943_939163945 -6 Left 939163943 2:138620308-138620330 CCTCAACCAGAAAAATAAAACTG No data
Right 939163945 2:138620325-138620347 AAACTGTTCTGAATGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939163943 Original CRISPR CAGTTTTATTTTTCTGGTTG AGG (reversed) Intergenic
No off target data available for this crispr