ID: 939163944

View in Genome Browser
Species Human (GRCh38)
Location 2:138620314-138620336
Sequence TCAGAACAGTTTTATTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939163944_939163947 -4 Left 939163944 2:138620314-138620336 CCAGAAAAATAAAACTGTTCTGA No data
Right 939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG No data
939163944_939163946 -5 Left 939163944 2:138620314-138620336 CCAGAAAAATAAAACTGTTCTGA No data
Right 939163946 2:138620332-138620354 TCTGAATGAAAAGAGGCAAGAGG No data
939163944_939163948 5 Left 939163944 2:138620314-138620336 CCAGAAAAATAAAACTGTTCTGA No data
Right 939163948 2:138620342-138620364 AAGAGGCAAGAGGGCCAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939163944 Original CRISPR TCAGAACAGTTTTATTTTTC TGG (reversed) Intergenic
No off target data available for this crispr