ID: 939163947 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:138620333-138620355 |
| Sequence | CTGAATGAAAAGAGGCAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939163944_939163947 | -4 | Left | 939163944 | 2:138620314-138620336 | CCAGAAAAATAAAACTGTTCTGA | No data | ||
| Right | 939163947 | 2:138620333-138620355 | CTGAATGAAAAGAGGCAAGAGGG | No data | ||||
| 939163943_939163947 | 2 | Left | 939163943 | 2:138620308-138620330 | CCTCAACCAGAAAAATAAAACTG | No data | ||
| Right | 939163947 | 2:138620333-138620355 | CTGAATGAAAAGAGGCAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939163947 | Original CRISPR | CTGAATGAAAAGAGGCAAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||