ID: 939163947

View in Genome Browser
Species Human (GRCh38)
Location 2:138620333-138620355
Sequence CTGAATGAAAAGAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939163944_939163947 -4 Left 939163944 2:138620314-138620336 CCAGAAAAATAAAACTGTTCTGA No data
Right 939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG No data
939163943_939163947 2 Left 939163943 2:138620308-138620330 CCTCAACCAGAAAAATAAAACTG No data
Right 939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939163947 Original CRISPR CTGAATGAAAAGAGGCAAGA GGG Intergenic
No off target data available for this crispr