ID: 939165842

View in Genome Browser
Species Human (GRCh38)
Location 2:138640463-138640485
Sequence CCAAATACCCTGGCATCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939165842_939165849 19 Left 939165842 2:138640463-138640485 CCAAGAGATGCCAGGGTATTTGG No data
Right 939165849 2:138640505-138640527 AAGGACTAAGTGTCATTCAGGGG No data
939165842_939165846 0 Left 939165842 2:138640463-138640485 CCAAGAGATGCCAGGGTATTTGG No data
Right 939165846 2:138640486-138640508 AGTTTGAAGGATAAAAATCAAGG No data
939165842_939165848 18 Left 939165842 2:138640463-138640485 CCAAGAGATGCCAGGGTATTTGG No data
Right 939165848 2:138640504-138640526 CAAGGACTAAGTGTCATTCAGGG No data
939165842_939165847 17 Left 939165842 2:138640463-138640485 CCAAGAGATGCCAGGGTATTTGG No data
Right 939165847 2:138640503-138640525 TCAAGGACTAAGTGTCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939165842 Original CRISPR CCAAATACCCTGGCATCTCT TGG (reversed) Intergenic
No off target data available for this crispr