ID: 939165844

View in Genome Browser
Species Human (GRCh38)
Location 2:138640473-138640495
Sequence CCTTCAAACTCCAAATACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939165844_939165848 8 Left 939165844 2:138640473-138640495 CCAGGGTATTTGGAGTTTGAAGG No data
Right 939165848 2:138640504-138640526 CAAGGACTAAGTGTCATTCAGGG No data
939165844_939165846 -10 Left 939165844 2:138640473-138640495 CCAGGGTATTTGGAGTTTGAAGG No data
Right 939165846 2:138640486-138640508 AGTTTGAAGGATAAAAATCAAGG No data
939165844_939165849 9 Left 939165844 2:138640473-138640495 CCAGGGTATTTGGAGTTTGAAGG No data
Right 939165849 2:138640505-138640527 AAGGACTAAGTGTCATTCAGGGG No data
939165844_939165850 24 Left 939165844 2:138640473-138640495 CCAGGGTATTTGGAGTTTGAAGG No data
Right 939165850 2:138640520-138640542 TTCAGGGGAATTGAGACTCATGG No data
939165844_939165847 7 Left 939165844 2:138640473-138640495 CCAGGGTATTTGGAGTTTGAAGG No data
Right 939165847 2:138640503-138640525 TCAAGGACTAAGTGTCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939165844 Original CRISPR CCTTCAAACTCCAAATACCC TGG (reversed) Intergenic
No off target data available for this crispr