ID: 939165847

View in Genome Browser
Species Human (GRCh38)
Location 2:138640503-138640525
Sequence TCAAGGACTAAGTGTCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939165844_939165847 7 Left 939165844 2:138640473-138640495 CCAGGGTATTTGGAGTTTGAAGG No data
Right 939165847 2:138640503-138640525 TCAAGGACTAAGTGTCATTCAGG No data
939165842_939165847 17 Left 939165842 2:138640463-138640485 CCAAGAGATGCCAGGGTATTTGG No data
Right 939165847 2:138640503-138640525 TCAAGGACTAAGTGTCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939165847 Original CRISPR TCAAGGACTAAGTGTCATTC AGG Intergenic
No off target data available for this crispr