ID: 939165849

View in Genome Browser
Species Human (GRCh38)
Location 2:138640505-138640527
Sequence AAGGACTAAGTGTCATTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939165842_939165849 19 Left 939165842 2:138640463-138640485 CCAAGAGATGCCAGGGTATTTGG No data
Right 939165849 2:138640505-138640527 AAGGACTAAGTGTCATTCAGGGG No data
939165844_939165849 9 Left 939165844 2:138640473-138640495 CCAGGGTATTTGGAGTTTGAAGG No data
Right 939165849 2:138640505-138640527 AAGGACTAAGTGTCATTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939165849 Original CRISPR AAGGACTAAGTGTCATTCAG GGG Intergenic
No off target data available for this crispr