ID: 939166200

View in Genome Browser
Species Human (GRCh38)
Location 2:138643665-138643687
Sequence CCCAGGATGCACCTACGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939166197_939166200 -10 Left 939166197 2:138643652-138643674 CCTGAAAGCAGGACCCAGGATGC No data
Right 939166200 2:138643665-138643687 CCCAGGATGCACCTACGTGTGGG No data
939166192_939166200 12 Left 939166192 2:138643630-138643652 CCCAGCAGTCTGCAAAGTCCTGC No data
Right 939166200 2:138643665-138643687 CCCAGGATGCACCTACGTGTGGG No data
939166195_939166200 -6 Left 939166195 2:138643648-138643670 CCTGCCTGAAAGCAGGACCCAGG No data
Right 939166200 2:138643665-138643687 CCCAGGATGCACCTACGTGTGGG No data
939166193_939166200 11 Left 939166193 2:138643631-138643653 CCAGCAGTCTGCAAAGTCCTGCC No data
Right 939166200 2:138643665-138643687 CCCAGGATGCACCTACGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939166200 Original CRISPR CCCAGGATGCACCTACGTGT GGG Intergenic
No off target data available for this crispr