ID: 939166454

View in Genome Browser
Species Human (GRCh38)
Location 2:138646148-138646170
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939166454_939166461 16 Left 939166454 2:138646148-138646170 CCAACCCCTTGTTTTTTCAGCAA No data
Right 939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG No data
939166454_939166458 -3 Left 939166454 2:138646148-138646170 CCAACCCCTTGTTTTTTCAGCAA No data
Right 939166458 2:138646168-138646190 CAAAGAAATGAAAGCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939166454 Original CRISPR TTGCTGAAAAAACAAGGGGT TGG (reversed) Intergenic
No off target data available for this crispr