ID: 939166455

View in Genome Browser
Species Human (GRCh38)
Location 2:138646152-138646174
Sequence TTCTTTGCTGAAAAAACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939166455_939166461 12 Left 939166455 2:138646152-138646174 CCCCTTGTTTTTTCAGCAAAGAA No data
Right 939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG No data
939166455_939166458 -7 Left 939166455 2:138646152-138646174 CCCCTTGTTTTTTCAGCAAAGAA No data
Right 939166458 2:138646168-138646190 CAAAGAAATGAAAGCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939166455 Original CRISPR TTCTTTGCTGAAAAAACAAG GGG (reversed) Intergenic
No off target data available for this crispr