ID: 939166458

View in Genome Browser
Species Human (GRCh38)
Location 2:138646168-138646190
Sequence CAAAGAAATGAAAGCCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939166457_939166458 -9 Left 939166457 2:138646154-138646176 CCTTGTTTTTTCAGCAAAGAAAT No data
Right 939166458 2:138646168-138646190 CAAAGAAATGAAAGCCCAAATGG No data
939166454_939166458 -3 Left 939166454 2:138646148-138646170 CCAACCCCTTGTTTTTTCAGCAA No data
Right 939166458 2:138646168-138646190 CAAAGAAATGAAAGCCCAAATGG No data
939166456_939166458 -8 Left 939166456 2:138646153-138646175 CCCTTGTTTTTTCAGCAAAGAAA No data
Right 939166458 2:138646168-138646190 CAAAGAAATGAAAGCCCAAATGG No data
939166455_939166458 -7 Left 939166455 2:138646152-138646174 CCCCTTGTTTTTTCAGCAAAGAA No data
Right 939166458 2:138646168-138646190 CAAAGAAATGAAAGCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939166458 Original CRISPR CAAAGAAATGAAAGCCCAAA TGG Intergenic
No off target data available for this crispr