ID: 939166461

View in Genome Browser
Species Human (GRCh38)
Location 2:138646187-138646209
Sequence ATGGTTAAACTGCTCATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939166455_939166461 12 Left 939166455 2:138646152-138646174 CCCCTTGTTTTTTCAGCAAAGAA No data
Right 939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG No data
939166456_939166461 11 Left 939166456 2:138646153-138646175 CCCTTGTTTTTTCAGCAAAGAAA No data
Right 939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG No data
939166454_939166461 16 Left 939166454 2:138646148-138646170 CCAACCCCTTGTTTTTTCAGCAA No data
Right 939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG No data
939166457_939166461 10 Left 939166457 2:138646154-138646176 CCTTGTTTTTTCAGCAAAGAAAT No data
Right 939166461 2:138646187-138646209 ATGGTTAAACTGCTCATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939166461 Original CRISPR ATGGTTAAACTGCTCATACA AGG Intergenic
No off target data available for this crispr