ID: 939168829

View in Genome Browser
Species Human (GRCh38)
Location 2:138670313-138670335
Sequence TCATCTGAGCTACAGTTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939168829_939168832 0 Left 939168829 2:138670313-138670335 CCACGCAACTGTAGCTCAGATGA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 939168832 2:138670336-138670358 TAAGGAACTTGGTTCCACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939168829 Original CRISPR TCATCTGAGCTACAGTTGCG TGG (reversed) Intergenic
909169407 1:72275798-72275820 TCATCTGATATACAGTTAAGAGG + Intronic
910460275 1:87441754-87441776 TCATCTGAGCTAGATGTGCCAGG + Intergenic
915623373 1:157099462-157099484 TCACCTGAGATCCAGTTGCCGGG + Exonic
924890122 1:248268402-248268424 CCATCTGAGGAACAGTTGTGAGG - Intergenic
1062975976 10:1683018-1683040 TCATCACAGCTTCATTTGCGTGG + Intronic
1063367622 10:5500679-5500701 TGATGTGATCTACAGTTGTGAGG + Intergenic
1075394353 10:122115843-122115865 TCATCTGTGCAAAAGTTGCAAGG - Intronic
1075417878 10:122278805-122278827 TCAGCTGAGCACCAGATGCGTGG - Intronic
1075564043 10:123490878-123490900 TCAGCAGAGCTACAGTTCCTGGG + Intergenic
1099564512 12:84225693-84225715 TTATCTGTGCTACAGTTTCAAGG + Intergenic
1102449311 12:113029000-113029022 TCATCTGAGCTAGAGTATAGTGG - Intergenic
1102507591 12:113393414-113393436 TCATCTGAGCAAGAGTTCCATGG + Intronic
1104078666 12:125411640-125411662 TCATCTGGGCTCCAGTTGACCGG + Intronic
1108852331 13:54747409-54747431 TCATCTGTGCTACTGTAGCCAGG - Intergenic
1113352083 13:109539194-109539216 TAATCTGAGATAAAGGTGCGTGG - Intergenic
1113389715 13:109883815-109883837 TGATCTGAGCTACTGATGCGAGG - Intergenic
1115502147 14:34059827-34059849 TGAACTGAGCTACAATGGCGAGG + Intronic
1125650050 15:41309424-41309446 TCCTCTGATCTAAAGTTGCATGG - Exonic
1127337354 15:58001561-58001583 TCATCTGAGGTATAGATGAGAGG - Intronic
1130812423 15:87393820-87393842 TCATCTGAGCTGCAGTGCAGTGG - Intergenic
1141039799 16:80663317-80663339 TCATCAGTTCTACAGTTGAGTGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1147869867 17:43579481-43579503 GCAACTGGGCTACAGTTGCTGGG + Intronic
1149862636 17:60131789-60131811 TTATCTGAGCTTCAGATGAGTGG + Intergenic
1158708231 18:59813673-59813695 TCTTCTGAGCTTCAGTTGCTTGG - Intergenic
1166002888 19:39888769-39888791 GCATCTGAGTTACAGTGGAGGGG - Intronic
1166005675 19:39905021-39905043 GCATCTGAGTTACAGTGGAGGGG - Intronic
930143930 2:47981865-47981887 TCACCTGAGCTACAGCCGGGTGG - Intergenic
931521187 2:63099016-63099038 TTTTCTGAGCTACAGTTTGGTGG + Intergenic
932614024 2:73220558-73220580 ACATCTGAGCTACAGCTCAGGGG + Intronic
939168829 2:138670313-138670335 TCATCTGAGCTACAGTTGCGTGG - Intergenic
944131129 2:196348606-196348628 TCATCTGGGCTACAGTGCAGTGG - Intronic
945297925 2:208189416-208189438 TCTTCTGACCTACAGTTTAGTGG - Intronic
1170982345 20:21226563-21226585 GCATCTGATCCACAGTTGGGCGG + Intronic
1172817737 20:37701775-37701797 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817738 20:37701815-37701837 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817739 20:37701855-37701877 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817740 20:37701895-37701917 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817741 20:37701935-37701957 TCATCTCAGCTGCAGATGTGTGG + Intronic
1173260462 20:41430454-41430476 TCATATGAGCTACTGCTGGGAGG + Intronic
1173901222 20:46590822-46590844 TCCTTTGAGCTACAGCTGCAAGG + Intronic
1177617606 21:23543648-23543670 TCATCTGAGAAACATTTGTGGGG - Intergenic
1179154206 21:38835760-38835782 TCTTCTGACTTACAGTTGGGAGG - Intergenic
1183990732 22:41595565-41595587 CCATCTGAGCACCAGTTGCCAGG - Intergenic
949256654 3:2055615-2055637 TCATTTGAGCTACAGATCCAGGG + Intergenic
958414183 3:93854496-93854518 TCAACTGAGCCACAGCTGGGTGG + Intergenic
972339412 4:38138255-38138277 GCATGTGAGCTGCAGTTGTGGGG + Exonic
972409884 4:38782939-38782961 TCAGCAGAGCTGCAGGTGCGTGG + Exonic
986812270 5:11373130-11373152 TGATCTTAGCTACAGTTGTCCGG + Intronic
988896976 5:35686134-35686156 TCATCTGAGATACAATTTTGAGG + Intronic
998617632 5:143758119-143758141 TCCTCTGAGCTACAGCTCTGGGG - Intergenic
1003591813 6:7442947-7442969 TCCCCTGAACTACAGTTGAGTGG + Intergenic
1003996909 6:11550800-11550822 TCAACTGAACTGCAGTTGAGTGG - Intronic
1012414686 6:99000409-99000431 TCAGCTGAGCTACAGTTGATAGG - Intergenic
1015151636 6:130045749-130045771 TCATTTGAGCTTCAGGTGCCTGG + Intronic
1032934500 7:136713287-136713309 TCATCTTAACTACAGGTGCAGGG - Intergenic
1036731164 8:11266345-11266367 TCATTTGAGCGAGAGTTGGGAGG - Intergenic
1039703984 8:39988888-39988910 TCATCTGAACTACACTTGGAAGG - Intronic
1044514580 8:93123288-93123310 TCAACTGATCTACAGCTGTGGGG + Intergenic
1046466556 8:114611756-114611778 TCATCTTTTCTACAGTTGCGAGG - Intergenic
1193124555 X:77857409-77857431 ACATATGAGTTACAGGTGCGGGG - Exonic