ID: 939169004

View in Genome Browser
Species Human (GRCh38)
Location 2:138672302-138672324
Sequence GAGGTATATTTTGAATTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939169002_939169004 5 Left 939169002 2:138672274-138672296 CCTTTATAAAAACAGAAAGTAAT No data
Right 939169004 2:138672302-138672324 GAGGTATATTTTGAATTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939169004 Original CRISPR GAGGTATATTTTGAATTAAT AGG Intronic
No off target data available for this crispr