ID: 939170872

View in Genome Browser
Species Human (GRCh38)
Location 2:138693778-138693800
Sequence GAGCAGGCTGTTCTGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939170872_939170878 8 Left 939170872 2:138693778-138693800 CCCATCAACAGAACAGCCTGCTC No data
Right 939170878 2:138693809-138693831 TCCACCTATGACAGTGTTATGGG No data
939170872_939170877 7 Left 939170872 2:138693778-138693800 CCCATCAACAGAACAGCCTGCTC No data
Right 939170877 2:138693808-138693830 CTCCACCTATGACAGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939170872 Original CRISPR GAGCAGGCTGTTCTGTTGAT GGG (reversed) Intronic
No off target data available for this crispr