ID: 939172167

View in Genome Browser
Species Human (GRCh38)
Location 2:138709058-138709080
Sequence ACACATGTATTCTAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939172159_939172167 25 Left 939172159 2:138709010-138709032 CCAAACAAAAAGCTTCAGAAACC No data
Right 939172167 2:138709058-138709080 ACACATGTATTCTAGCAGCAGGG No data
939172160_939172167 4 Left 939172160 2:138709031-138709053 CCAGCACTTCAAATACTCCCCTG No data
Right 939172167 2:138709058-138709080 ACACATGTATTCTAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939172167 Original CRISPR ACACATGTATTCTAGCAGCA GGG Intronic
No off target data available for this crispr