ID: 939172213

View in Genome Browser
Species Human (GRCh38)
Location 2:138709439-138709461
Sequence CTGTGGGTAGGGAGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939172213_939172227 12 Left 939172213 2:138709439-138709461 CCTGCCCCCCTCCCTACCCACAG No data
Right 939172227 2:138709474-138709496 CACCTTTCCCCCCACCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939172213 Original CRISPR CTGTGGGTAGGGAGGGGGGC AGG (reversed) Intronic
No off target data available for this crispr