ID: 939178605

View in Genome Browser
Species Human (GRCh38)
Location 2:138780190-138780212
Sequence GGTCCCTGGCTTGCTGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 306}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939178605_939178613 1 Left 939178605 2:138780190-138780212 CCAGCTGCAGCAAGCCAGGGACC 0: 1
1: 0
2: 4
3: 45
4: 306
Right 939178613 2:138780214-138780236 CCACGAGGGGCAGCGGCCGCAGG 0: 1
1: 0
2: 1
3: 16
4: 212
939178605_939178615 14 Left 939178605 2:138780190-138780212 CCAGCTGCAGCAAGCCAGGGACC 0: 1
1: 0
2: 4
3: 45
4: 306
Right 939178615 2:138780227-138780249 CGGCCGCAGGCGCATGGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 88
939178605_939178618 23 Left 939178605 2:138780190-138780212 CCAGCTGCAGCAAGCCAGGGACC 0: 1
1: 0
2: 4
3: 45
4: 306
Right 939178618 2:138780236-138780258 GCGCATGGTGCCGGCTGGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 130
939178605_939178610 -6 Left 939178605 2:138780190-138780212 CCAGCTGCAGCAAGCCAGGGACC 0: 1
1: 0
2: 4
3: 45
4: 306
Right 939178610 2:138780207-138780229 GGGACCACCACGAGGGGCAGCGG 0: 1
1: 0
2: 0
3: 28
4: 225
939178605_939178614 8 Left 939178605 2:138780190-138780212 CCAGCTGCAGCAAGCCAGGGACC 0: 1
1: 0
2: 4
3: 45
4: 306
Right 939178614 2:138780221-138780243 GGGCAGCGGCCGCAGGCGCATGG 0: 1
1: 0
2: 1
3: 33
4: 309
939178605_939178617 18 Left 939178605 2:138780190-138780212 CCAGCTGCAGCAAGCCAGGGACC 0: 1
1: 0
2: 4
3: 45
4: 306
Right 939178617 2:138780231-138780253 CGCAGGCGCATGGTGCCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939178605 Original CRISPR GGTCCCTGGCTTGCTGCAGC TGG (reversed) Exonic
900371271 1:2333243-2333265 TGTCCCCGGCCTGTTGCAGCGGG - Intronic
900392325 1:2439050-2439072 GGTCCCTGTCTTGCTAGACCTGG + Intronic
900496451 1:2978141-2978163 GGCCCCTGGCTCTCTGCTGCTGG - Intergenic
900656786 1:3762561-3762583 TGTCCCTGGGGTGCTGCAGGAGG + Intronic
900932709 1:5747089-5747111 GGCCCATGGCTTCCTCCAGCAGG - Intergenic
901456503 1:9366128-9366150 GGTGCCTGGGAGGCTGCAGCTGG + Intronic
901535937 1:9883093-9883115 GGTGCCTGGGTGGCAGCAGCGGG + Intronic
902033893 1:13442471-13442493 GGTACCTGGCTTGTGGCAGCAGG + Intergenic
902691773 1:18114292-18114314 GGTCCCTGCCTGGGTGGAGCAGG - Intronic
902724063 1:18323614-18323636 GGTCCCAGGCTCCCTGAAGCGGG + Intronic
903168294 1:21536655-21536677 GGACCCTGACTGGCTCCAGCTGG - Intronic
903207662 1:21795065-21795087 GGCCCCGGGCCTGCTGCAGGAGG + Intergenic
903552857 1:24169969-24169991 GGTCCTTGGCATGCAGCAGGTGG - Intronic
904307778 1:29601310-29601332 GGTCTCTGGCTGGGTCCAGCGGG - Intergenic
904886168 1:33740232-33740254 GTTCCCTGCCTTCCTCCAGCAGG + Intronic
905271502 1:36790566-36790588 GCTCCTTGGCTTGCTCCAGATGG + Intergenic
905946414 1:41904892-41904914 GGCCCTTGGCTTGCAGAAGCGGG + Intronic
906219084 1:44063803-44063825 TTTATCTGGCTTGCTGCAGCAGG + Intergenic
906526588 1:46496837-46496859 GAGCCCTGGCTTGCTGCTCCCGG + Intergenic
906577083 1:46900687-46900709 GGTCCCTGACTTCCCGCAACAGG - Intergenic
909577196 1:77187776-77187798 GGTCCCTGACTTCCCGCAACAGG - Intronic
912723268 1:112037718-112037740 GGGCCCTGGCTTTCTCCACCTGG - Intergenic
913700054 1:121365652-121365674 GGTCCCTGGTTTGCTGCTAACGG - Intronic
914040603 1:144046105-144046127 GGTCCCTGGTTTGCTGCTAACGG - Intergenic
914137484 1:144914374-144914396 GGTCCCTGGTTTGCTGCTAACGG + Intronic
915456162 1:156042152-156042174 GCTCCCAGTCTTCCTGCAGCAGG - Exonic
915471168 1:156126567-156126589 GGGCCCGGGCCTGCTGCAGCTGG + Intronic
919976867 1:202618505-202618527 GGTCCCAGGCCTGCTGCAAGAGG - Intronic
920909057 1:210197062-210197084 GGTCCCTGACTTCCCGCAACAGG + Intergenic
921081138 1:211739125-211739147 GGTACCTGTCTGACTGCAGCAGG - Intergenic
922344329 1:224683762-224683784 GGGCTCTGGCTTGCTGGAGAAGG + Intronic
922769139 1:228172748-228172770 GGTCACTGGCATGCTGCTGGTGG - Intronic
924230521 1:241958468-241958490 GGACCCTGGCATACTGCAGCTGG - Intergenic
1063378718 10:5570677-5570699 GGTCCCTGCCTTGCTTTTGCAGG + Intergenic
1063948130 10:11197212-11197234 GGTCAGTGACTTGCTTCAGCTGG + Intronic
1064376564 10:14801856-14801878 GCTCCCTGGCCTTCTGCACCTGG + Intergenic
1065201348 10:23316214-23316236 GCTGCCTGCCCTGCTGCAGCTGG - Intronic
1065328386 10:24569981-24570003 GGTCCCTTCCTAACTGCAGCTGG - Intergenic
1066300420 10:34091103-34091125 GGTCCCAGGCTTGGAGCAGGAGG + Intergenic
1066349562 10:34624817-34624839 GGGCCTTGTCTTGCTGCAGTGGG - Intronic
1067101541 10:43338241-43338263 CGCCCCTGGCATGCTGAAGCAGG - Intergenic
1067188440 10:44049885-44049907 GGTCTCTGGATTACTGCTGCAGG + Intergenic
1067577929 10:47419629-47419651 GGACCCTGGTTTGGAGCAGCAGG - Intergenic
1069885332 10:71620106-71620128 GGTCCCTCGGTCCCTGCAGCAGG + Intronic
1070463391 10:76692200-76692222 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1070544565 10:77442306-77442328 GGTGCCTGGCTTCCTCCTGCAGG - Intronic
1070736407 10:78866507-78866529 GGGCCCTGGCTTGCAGCAGGAGG - Intergenic
1071183848 10:83018426-83018448 GGTCCCTGACTTCCTGCAACAGG - Intergenic
1074211815 10:111342184-111342206 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1074768918 10:116720744-116720766 AGGACCTGGCTAGCTGCAGCTGG - Intronic
1076203118 10:128573515-128573537 CGTCCCTGGCTTGCTGCATGGGG + Intergenic
1076277233 10:129211950-129211972 TGCTCCTGGCTTTCTGCAGCCGG - Intergenic
1076850244 10:133088924-133088946 GGTCCCGGGGGTCCTGCAGCTGG + Intronic
1077042272 11:530065-530087 GGTCCCTGGGTGGCTTCAACAGG - Intergenic
1077050937 11:566505-566527 CGTCCCTGGTCTGCTGCTGCTGG + Intergenic
1077155550 11:1089366-1089388 GGGCCCTGGCTGGCTGGTGCTGG + Intergenic
1077252189 11:1565591-1565613 GGTACCTGGCTGCGTGCAGCCGG + Exonic
1077253397 11:1570642-1570664 AGCCCCCGGCTGGCTGCAGCAGG + Intronic
1078509774 11:11976685-11976707 GGACCCTGCCCTCCTGCAGCAGG - Intronic
1079443497 11:20538367-20538389 GGTCCCTGACTTACCGCAACAGG - Intergenic
1080208440 11:29756958-29756980 TGTACCTGCCCTGCTGCAGCTGG + Intergenic
1081153787 11:39664263-39664285 GGACCCAGGCTTGCTGCAGGAGG - Intergenic
1081671738 11:44946293-44946315 GGGCCTTGGCTGGCTCCAGCTGG + Intronic
1082254751 11:50021311-50021333 TCTCCCAGGTTTGCTGCAGCAGG - Intergenic
1083656533 11:64232426-64232448 GGTCCCGGTCTGGGTGCAGCTGG - Exonic
1083920398 11:65779139-65779161 GCTGGCTGGCTTGCGGCAGCGGG - Exonic
1085347099 11:75775278-75775300 GATGCCTGGCTCCCTGCAGCAGG + Intronic
1085523754 11:77152799-77152821 GGTGCCTGGCTTCCTGGAGGAGG + Intronic
1087011175 11:93515653-93515675 GAAAGCTGGCTTGCTGCAGCTGG - Intronic
1088651251 11:111959405-111959427 GCTCCCTGCGATGCTGCAGCTGG - Intronic
1089175665 11:116547299-116547321 GGTCCCTGGATTGCAGTAGGTGG - Intergenic
1090071735 11:123550024-123550046 GGTGCCTGGCTTTCTGCAGTTGG - Intronic
1090156410 11:124442946-124442968 GATGCCTGGCTTGGGGCAGCAGG - Intergenic
1090363130 11:126186966-126186988 TTTCTCTGGCTTCCTGCAGCTGG - Intergenic
1090403837 11:126465726-126465748 TGCCCCCGGCTTGCTGCATCTGG - Intronic
1090941336 11:131390723-131390745 GGTCCCTGGCTGGCAGCATCAGG + Intronic
1092530155 12:9337329-9337351 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1092678260 12:10946348-10946370 GGTCTCTGACTTCCAGCAGCAGG + Intronic
1098702344 12:73645312-73645334 GGCCCTGGGCTTGCTGCAGGAGG + Intergenic
1100613138 12:96208845-96208867 GGTCCCGGGCCAGGTGCAGCTGG + Intronic
1101320734 12:103670849-103670871 GTTCCCTCTCGTGCTGCAGCAGG + Intronic
1102430165 12:112876791-112876813 GGTGGCTGGCGGGCTGCAGCAGG - Exonic
1102957792 12:117070591-117070613 TGCCCCTGGCTTCCTACAGCAGG + Intronic
1104043512 12:125145707-125145729 GGTCAGTGGCTGACTGCAGCTGG - Intergenic
1105301805 13:19141997-19142019 AATCCCTGCCCTGCTGCAGCTGG - Intergenic
1106336960 13:28792245-28792267 TGTCCCTGGCTTGCTGGACTGGG + Intergenic
1107520558 13:41176357-41176379 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1109267914 13:60221803-60221825 GGCCCCAGGCTGGCTGCAGGAGG - Intergenic
1112793558 13:103029891-103029913 GGTCCCTGGCCTGCAGGTGCTGG + Intergenic
1113523298 13:110955323-110955345 GGTCCCGTGCAGGCTGCAGCTGG - Intergenic
1113702009 13:112395173-112395195 GGTCCCGTGCAGGCTGCAGCTGG + Intronic
1113892131 13:113742040-113742062 GGTCCCTGGCATTCTTCGGCTGG + Intergenic
1114756188 14:25262866-25262888 GGACCCTGACATGCTGCATCTGG + Intergenic
1114892502 14:26942890-26942912 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1115479315 14:33845817-33845839 GGGCCCTGGCTTGTTGTGGCTGG - Intergenic
1115884636 14:37957816-37957838 GGTCCCTGACTTGCCGCAACAGG - Intronic
1116657752 14:47673825-47673847 GGACACTAGCTCGCTGCAGCGGG - Intronic
1116860933 14:49995147-49995169 GGACCCTGACTTGCTCCAGAGGG + Intronic
1118786548 14:69050289-69050311 AGTCCCAGCCTTGCAGCAGCAGG - Intergenic
1119128986 14:72154514-72154536 GGTCCCTGACTTCCAACAGCTGG + Intronic
1119206522 14:72798611-72798633 GGTCCCTAGTTGGCTGCAGCAGG + Intronic
1119325625 14:73758488-73758510 GATGTCTGGCTTGCTCCAGCAGG - Intronic
1119409628 14:74422328-74422350 GTCCCCTGGCTTGCAGCAGAGGG + Intronic
1120592412 14:86391283-86391305 GCTGCCTGCCTAGCTGCAGCTGG + Intergenic
1121608273 14:95257261-95257283 GGTCCCCGTCTAGATGCAGCGGG - Intronic
1123690441 15:22834217-22834239 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1125827804 15:42690978-42691000 GGTCCCTGAGTTGTTGCAGGTGG - Exonic
1128077920 15:64839916-64839938 GGTCTCTGGTCTGCTGCAGGTGG + Intergenic
1128760650 15:70214112-70214134 GGCCCCAGGCTGGCTGCAGCGGG + Intergenic
1128791441 15:70437508-70437530 GGTCAGTGGCATGCTGGAGCCGG + Intergenic
1129510466 15:76117977-76117999 GTTCTCAGGCCTGCTGCAGCTGG + Intronic
1129813456 15:78530310-78530332 GCTACCTGGATGGCTGCAGCAGG - Intronic
1130988681 15:88861636-88861658 GGTCCCGGGCTTACTGCAGAAGG + Intronic
1131530550 15:93187694-93187716 GCTCCCTGGCCTGAAGCAGCAGG + Intergenic
1132211704 15:100028682-100028704 GGTCCCCTGCTGGCAGCAGCGGG + Intronic
1132622716 16:875332-875354 GGTCCCTGTCTGCCTGCACCAGG + Intronic
1132675562 16:1119908-1119930 GGCCCCAGGCCTGCTGCAGCGGG - Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134406637 16:13965233-13965255 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1135770861 16:25217368-25217390 GGACACTGGGCTGCTGCAGCCGG + Exonic
1135947112 16:26874972-26874994 GGTCCCTTGCTTCTTGCATCGGG + Intergenic
1138251028 16:55502059-55502081 GGGCCCAGGATTGCTGCCGCCGG + Intronic
1138561477 16:57803197-57803219 GTTCCCGGCCTTGCTGCAGAAGG + Intronic
1139653478 16:68374129-68374151 AGTCCCAGGCTTGCACCAGCAGG + Intronic
1140427025 16:74869584-74869606 GGTCTCTGGCCTGCTGGAGGCGG - Intergenic
1141666282 16:85467112-85467134 GGGCCCTGGCCTCCAGCAGCTGG + Intergenic
1141691413 16:85598845-85598867 GGCCCCTTGTTTGCTGGAGCAGG + Intergenic
1142227355 16:88884160-88884182 GGCGTCTGGCATGCTGCAGCCGG - Intronic
1142396894 16:89837237-89837259 GTTCCCTGGTCTGCTGCTGCAGG + Intronic
1144733424 17:17541549-17541571 GGGCTCTGGCTCGCTGGAGCTGG - Intronic
1146120051 17:30184957-30184979 GGTCTCTGGATTGCTTCTGCTGG - Exonic
1147232391 17:39028955-39028977 GGTCCCTTGCTGGTTGCAGAGGG - Intergenic
1148053616 17:44780920-44780942 GCTCTCAGGCTCGCTGCAGCAGG - Exonic
1148093548 17:45037018-45037040 GGTGCCTGGCTTGGGGCAGCAGG + Intronic
1149581327 17:57752355-57752377 GGGCACTGGCTTCCTGCACCAGG - Intergenic
1149681035 17:58507271-58507293 GATCTCTGGCTGGCTGCAGCGGG + Exonic
1150640705 17:66947640-66947662 GGGCCCTGCCAGGCTGCAGCTGG - Intergenic
1151272214 17:73005586-73005608 GGTCCCTAGGTGGCTGGAGCGGG - Intronic
1151343547 17:73487268-73487290 GGTGGCTGGCTTTCTTCAGCAGG + Intronic
1151727495 17:75893259-75893281 GGTCCCTGTCTCACTGCAGAGGG + Intronic
1152084773 17:78211393-78211415 GGGCCCAGGCTCGCTGCAGATGG + Intergenic
1152415153 17:80155119-80155141 GGTCCCTGGCTTCCTGCAACAGG - Intergenic
1152655775 17:81518639-81518661 GCTCCCCGGCCTGCTGCCGCGGG - Intronic
1153666233 18:7369748-7369770 GAGCCATGGCTTGCTGCAGCGGG - Intergenic
1153777720 18:8468367-8468389 GGTCCCTGGCATGGTGCATTAGG - Intergenic
1155819963 18:30362430-30362452 GGTCCTGGGCCTGCTGCAGGAGG - Intergenic
1157042798 18:44060452-44060474 GCTCCCTGTATGGCTGCAGCTGG + Intergenic
1157467539 18:47960298-47960320 GGTCCCTGACTTCCTGCAACAGG - Intergenic
1158407345 18:57171859-57171881 GGTCCCTGACTTCCTGCAACTGG - Intergenic
1159334444 18:67044517-67044539 GCTGCCTGCCCTGCTGCAGCTGG + Intergenic
1159574158 18:70155714-70155736 GGTCCCTGACTTCCCGCAACAGG - Intronic
1159792317 18:72797747-72797769 GGTCCCTGGCTCCATGCTGCTGG + Intronic
1160535753 18:79590437-79590459 GGACTCTGTCCTGCTGCAGCAGG + Intergenic
1160818590 19:1047581-1047603 GGTCTCTGGCCTTCTGCTGCTGG + Exonic
1160820474 19:1055394-1055416 GGTCCTTGGGTTGCTGGGGCTGG + Intronic
1161226718 19:3150344-3150366 GCTGGCTGGCTTCCTGCAGCAGG + Intronic
1161315929 19:3617667-3617689 CCTCCCAGGCTTCCTGCAGCCGG + Intronic
1161592850 19:5136581-5136603 GGTCCCAGGCCTGCCACAGCCGG + Intronic
1161706777 19:5825805-5825827 TGTCCCTGCCTCCCTGCAGCGGG - Intronic
1161767844 19:6216789-6216811 GGCCCCTCCATTGCTGCAGCCGG + Intronic
1163329545 19:16627883-16627905 GGTCGATGGCCTGCAGCAGCCGG + Exonic
1163602427 19:18257158-18257180 GGACCCTGGCTCCCTGCAGTGGG - Exonic
1164754793 19:30681527-30681549 TGTCCCTGGCCTGCTTTAGCTGG + Intronic
1165812945 19:38623290-38623312 GGTCCCTGACTTCCCGCAACAGG + Intronic
1166337455 19:42116951-42116973 GGGCCTGGGCTTGCTGCAGGAGG + Intronic
1166752331 19:45170256-45170278 AGTCCCTGCCCTGCTGGAGCTGG + Intronic
1166912224 19:46167217-46167239 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1166913310 19:46176726-46176748 GGTCCCTGCCACCCTGCAGCAGG + Intergenic
1167557127 19:50203549-50203571 GGGCCGTAGCTTGCCGCAGCGGG + Intronic
1167586654 19:50379115-50379137 AGTGCCTGGTTTCCTGCAGCTGG + Exonic
1168348332 19:55661410-55661432 GATCCCTGGGTTGCTGGAGGAGG - Intronic
925409991 2:3634462-3634484 GGGCCCTGCTTTGCTGCAGGAGG - Intronic
926317884 2:11724731-11724753 AGGCCCTGGCTTGCTGAAGGGGG + Intronic
928024860 2:27730881-27730903 GATCCCTGGTTTGCAGGAGCGGG - Intergenic
929570809 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG + Intergenic
929976866 2:46643621-46643643 GGTCCCTGACTTCCCGCAACAGG + Intergenic
930573116 2:53112060-53112082 GGTCCCTGACTTCCTGTAACAGG - Intergenic
932104084 2:68927082-68927104 GGTCCCGGGCTGCATGCAGCCGG - Intergenic
933408608 2:81895931-81895953 GGAACCTGGCTTGCCGCAGGTGG - Intergenic
933665020 2:84957896-84957918 GGTCCCTGGCTTCCTCAAACAGG + Intergenic
934762869 2:96865996-96866018 CGTCCCTGTGTTGCTGCTGCAGG - Intronic
935364770 2:102277735-102277757 GCTCCCTGGGTTGATGAAGCAGG - Intergenic
936485025 2:112918108-112918130 GGACCCTGGCGTGCTGCTGTAGG + Intronic
936694493 2:114929986-114930008 GGTCCCTGACTTCCTGCAGCAGG + Intronic
937069937 2:119055566-119055588 GATCCCTGACTTCCTGCAACAGG + Intergenic
938105680 2:128528382-128528404 GATCCCTGGAGTGCTGGAGCAGG - Intergenic
938568914 2:132544548-132544570 TGCCCCAGGCTTGCTGCAGGAGG + Intronic
938978423 2:136502296-136502318 GGTCTCCAGCTTGCTGCTGCAGG - Intergenic
939178605 2:138780190-138780212 GGTCCCTGGCTTGCTGCAGCTGG - Exonic
939466274 2:142561611-142561633 TGCCCCTCCCTTGCTGCAGCTGG - Intergenic
940242220 2:151575584-151575606 GGTCCCTGACTTCCCGCAACAGG - Intronic
941043736 2:160649822-160649844 GGTGCCTGTCCTGCTGCAGCTGG + Intergenic
942094604 2:172525189-172525211 GGTCCCAGACTTCCTGCAACAGG - Intergenic
942232170 2:173870769-173870791 GGTCACTGGCTTCCTGGAGCAGG - Intergenic
943233757 2:185291432-185291454 GGTCTCTGGATGGCTGCAGGTGG - Intergenic
945488635 2:210428083-210428105 GGTCCCTGACTTCCTGCAACAGG + Intergenic
945611600 2:212011290-212011312 GGTCCCTGACTTCCTGCAGCAGG + Intronic
946880819 2:224175722-224175744 GGGCGCTGGCCAGCTGCAGCTGG + Intergenic
947791982 2:232873724-232873746 GGCCCCTGGCGTGCTGCCTCAGG - Intronic
948339809 2:237240504-237240526 GGTCCCTGACTTCCCGCAACAGG - Intergenic
948434561 2:237944279-237944301 CGTCCCTTCCTTCCTGCAGCTGG - Intergenic
948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG + Intronic
948676858 2:239601958-239601980 GGTGGCTGGCTGGCTGCAGCTGG - Intergenic
948860738 2:240751514-240751536 GGTTTCTGACTTGCTGCTGCAGG - Intronic
948886683 2:240888336-240888358 GGTCACTGGCTGGCAGCTGCAGG + Exonic
1168830906 20:844873-844895 GGTCCCTGGCTACCTGCTACGGG + Exonic
1170457575 20:16547807-16547829 GGTCCACGGCATGCTGCATCTGG + Intronic
1170924717 20:20712481-20712503 GGGCCCGGGCTTCCTGCCGCGGG - Exonic
1171294885 20:24008709-24008731 GGGCCCTGTGTGGCTGCAGCAGG - Intergenic
1171492529 20:25531601-25531623 GGTCCCTGACTTCCCGCAACAGG + Intronic
1171975890 20:31594419-31594441 GGTCTCTGGCCTGGTGCAGGTGG + Intergenic
1172502544 20:35437475-35437497 GCTCCCTGGCCTTCTTCAGCAGG + Exonic
1173363940 20:42368409-42368431 GGTCCCTGGGATGCTAAAGCTGG - Intronic
1174271386 20:49372012-49372034 GGTACTTTCCTTGCTGCAGCAGG + Exonic
1174527794 20:51187713-51187735 GGTCCCTGACTTCCCGCAACAGG - Intergenic
1174540907 20:51288573-51288595 CCTCCCTGGCTTCCTGTAGCTGG + Intergenic
1175285876 20:57836430-57836452 GGTCCCAGGCTGGGTGCTGCAGG + Intergenic
1175312765 20:58023515-58023537 GCTGCCTGTCTTGCAGCAGCTGG - Intergenic
1176447479 21:6832132-6832154 TGGCCCTGGGTTACTGCAGCTGG + Intergenic
1176825648 21:13697158-13697180 TGGCCCTGGGTTACTGCAGCTGG + Intergenic
1179257269 21:39727641-39727663 GGTCCCTGGTTAGCTGCAGGTGG + Intergenic
1179438864 21:41379646-41379668 GCTCCCCGTCTTTCTGCAGCTGG - Intronic
1179523756 21:41962160-41962182 GGTCCCTGGTGTTCTGAAGCAGG + Intergenic
1179772617 21:43634106-43634128 TGGCACTGGCTTGCTGCACCAGG - Intronic
1179950238 21:44705019-44705041 GGTCCCTGACTTCCAGCAACAGG - Intronic
1179984544 21:44913359-44913381 GGTCCATATCTTGCTGCTGCTGG - Intronic
1181143863 22:20829280-20829302 GGTCCTAGGCTTTCTTCAGCTGG + Intronic
1182441127 22:30365017-30365039 GGTCCCTGGCTGGCCGCACTGGG + Intronic
1183037112 22:35148824-35148846 AGCCCCTGGCTTGCCCCAGCAGG - Intergenic
1183037400 22:35150638-35150660 AGCCCCTGGCTTGCCCCAGCAGG + Intergenic
1183226097 22:36550934-36550956 GGTTCCTGGCCAGCTGCAACCGG - Intergenic
1183507710 22:38218806-38218828 GGGGCCTGGCTTGCTGCTGACGG - Intergenic
1184667770 22:45997658-45997680 GGGCCCTGGCTTCCTCCAGCAGG - Intergenic
1184675476 22:46040456-46040478 TGTCCCTGGCCTGCTACAGCTGG - Intergenic
1184693904 22:46129475-46129497 GGTGCCTCTCTTGCTGCAGGAGG + Intergenic
1184732263 22:46377476-46377498 GGAGCCTGGCGTGCTGCCGCAGG - Intronic
1185331454 22:50253872-50253894 GGTCCCTGGGTGCCCGCAGCAGG - Intronic
949240042 3:1859937-1859959 TTTCCCTGGCTGGCTGCAGAAGG + Intergenic
950207715 3:11093286-11093308 GGTCCCTGTGAGGCTGCAGCTGG - Intergenic
952793449 3:37218302-37218324 GCTCCCTGGGAGGCTGCAGCTGG - Intergenic
954507436 3:51090746-51090768 GGGCCTTGGCTTGCTGCATGTGG + Intronic
958625336 3:96615521-96615543 GGTCCCTGACTTCCTGCAACAGG + Intergenic
958834311 3:99126403-99126425 TCTCACTGGCTTGCTGCATCTGG - Intergenic
960819903 3:121718417-121718439 GGTCGTTGACTTGCTGCAACAGG - Exonic
962120375 3:132554612-132554634 GTTCCCTGCCCTTCTGCAGCTGG + Intergenic
963663951 3:148158875-148158897 GGTCCCTGACTTCCCGCAACAGG - Intergenic
964347638 3:155770330-155770352 GGCCCCGGGCTTGCTACAGGAGG - Intronic
964371995 3:156009590-156009612 TGTCCCCATCTTGCTGCAGCTGG - Intergenic
964840148 3:160984669-160984691 GGTCCCTGACTTCCTGCAACAGG + Intronic
965928987 3:174018563-174018585 GGTCCCTGACTTCCTGCAACAGG + Intronic
966817258 3:183899414-183899436 GGTCCCTGACTTCCCGCAACAGG - Intergenic
967258098 3:187613695-187613717 GCTGCCTGGCATGCAGCAGCAGG + Intergenic
968062149 3:195733704-195733726 GGTCCCTGCCCTGCTGCAGCGGG - Intronic
968761538 4:2444817-2444839 AGCCCCTGGATTCCTGCAGCAGG + Intronic
969138608 4:5050810-5050832 GGTCCCTGGGCTCCTGCGGCGGG - Intergenic
969175908 4:5398979-5399001 GAGCCCAGGCTTGCTGAAGCAGG - Intronic
969273392 4:6118261-6118283 GGTCCCTGACTTCCCGCAACAGG + Intronic
974644107 4:64670916-64670938 GCTGCCTGTCCTGCTGCAGCTGG - Intergenic
978425902 4:108582015-108582037 AGTGCTTGACTTGCTGCAGCAGG + Intergenic
978822164 4:112979247-112979269 GCTGCCTGCCTTGCTGCAGCCGG - Intronic
979027163 4:115592251-115592273 GGTCCCTGACTTCCCGCAACAGG - Intergenic
981754110 4:148122629-148122651 GGTCCCTGACTTCCAGCAACAGG - Intronic
982587200 4:157257810-157257832 GGTCCCTGACTTCCCGCAACAGG - Intronic
982727399 4:158920021-158920043 GGTCCCTGACTTCCCGCAACAGG - Intronic
983612223 4:169660267-169660289 TCTCCCTTGCTTGCTGCAGCAGG + Intronic
983885301 4:172974794-172974816 GCTGCCTGCCCTGCTGCAGCCGG - Intronic
984853709 4:184175271-184175293 GGATCTTGGCTTGCTGAAGCAGG - Intronic
984866881 4:184288540-184288562 TGTCCCAGCCCTGCTGCAGCAGG + Intergenic
986000522 5:3627498-3627520 GGACCCTGCCTTCCTGCGGCGGG + Intergenic
986833376 5:11607079-11607101 GTTCCCTGGCTTACAGAAGCAGG - Intronic
989830845 5:45916340-45916362 GGTGCCTGACTTCCTGCAACAGG + Intergenic
996110206 5:119556509-119556531 GGTCCCAGGCTTGATGAAGGTGG - Intronic
997115660 5:131123219-131123241 GGTCCCTGACTTCCCGCAACAGG - Intergenic
997244897 5:132339134-132339156 GGTCCCTAACTTCCTGCAACAGG + Intronic
997585446 5:135040521-135040543 CGTTCCTGGCTGGCTGCCGCTGG + Intronic
998259788 5:140621242-140621264 GGTCCCTGACTTCCTGCAACAGG - Intergenic
998585253 5:143420481-143420503 GGTCCCTGACTTCCCGCAACAGG + Intronic
999690321 5:154140780-154140802 GGACCCTGTCATGCTGCAGGAGG - Intronic
1000902745 5:166929516-166929538 TGTCTTTGGCTTTCTGCAGCTGG - Intergenic
1001511019 5:172321863-172321885 GGGGCCTGGCCTGATGCAGCTGG + Intergenic
1001906680 5:175478833-175478855 GATCCCTGGCATCCTGCGGCCGG + Intronic
1002063566 5:176640988-176641010 GGTCCCTGGCCAGCAGCATCTGG + Intronic
1002330045 5:178434856-178434878 GATGCCTGCCTTCCTGCAGCGGG - Intronic
1002540940 5:179906543-179906565 GGTCCCTCGCTTTCTTCATCGGG + Intronic
1003234194 6:4281549-4281571 GGTCCATGGTTTGGTCCAGCTGG + Intergenic
1004280331 6:14275010-14275032 GGTGCCTGTGTTTCTGCAGCTGG - Intergenic
1006292776 6:33152929-33152951 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1007751689 6:44075230-44075252 GGTCCCTGGCATGGTGGGGCAGG + Intergenic
1008023983 6:46612847-46612869 GGGCCCTGGCAGGCTGCAGTTGG + Intronic
1008170653 6:48201745-48201767 GGTCCCTGACTTCCCGCAACAGG - Intergenic
1010493032 6:76496678-76496700 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1013607068 6:111760412-111760434 AGTGCCTGGATGGCTGCAGCAGG + Intronic
1015339269 6:132079286-132079308 GGTCCCACAGTTGCTGCAGCAGG + Intergenic
1015626103 6:135181868-135181890 GGTGCCTGGCTTGATGCCGCGGG + Intronic
1017993292 6:159508984-159509006 GCTCCCATGATTGCTGCAGCTGG + Intergenic
1018914840 6:168126873-168126895 GGAGCCAGCCTTGCTGCAGCCGG - Intergenic
1018985106 6:168630229-168630251 GGTCCCTGACTTCCCGCAACAGG - Intronic
1019190531 6:170248213-170248235 AGACCCTGGCTGTCTGCAGCAGG - Intergenic
1019377188 7:699099-699121 GGCCCCTGGCGTGCTGGGGCAGG - Intronic
1019527578 7:1487596-1487618 CGTCCCTGGCTTACTGCTGTGGG - Intronic
1020070542 7:5224079-5224101 GGCCCCTGCCTTGGTTCAGCAGG + Intronic
1020909408 7:14109588-14109610 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1023603920 7:41909931-41909953 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1024942306 7:54775574-54775596 GGTCCCTGACTTCCTGCAACAGG - Intergenic
1025743815 7:64225558-64225580 GGTCCCTGACTTCCCGCAACAGG + Intronic
1025801878 7:64794421-64794443 GGTCTTTGTCTCGCTGCAGCGGG + Exonic
1026024237 7:66732229-66732251 GCCCCATGGCTAGCTGCAGCTGG - Intronic
1027991493 7:85368902-85368924 GATCCCTGGAATCCTGCAGCAGG - Intergenic
1028539452 7:91926045-91926067 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1030324414 7:108204371-108204393 TGCCCCTGGCCTTCTGCAGCTGG - Intronic
1031229394 7:119085680-119085702 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1031973786 7:128081527-128081549 GGTTCCTGGCTTGGTCCAGCTGG + Intronic
1032062907 7:128739561-128739583 GGTCCCAGGCCTGATGCTGCTGG + Intronic
1032565903 7:132942891-132942913 GGTATCTGGTTTGCTGCAGGAGG + Intronic
1032769219 7:135032094-135032116 GAGCCCTGGCTTGCTGCATAGGG - Intronic
1033145369 7:138866542-138866564 GAGCCCTGCCTTGCTGCAGCAGG - Intronic
1034669705 7:152848773-152848795 GATCCCTGGCTTCCTTCAGATGG - Intronic
1035572920 8:685695-685717 GGTCCCTGACTTCCTGCAATAGG + Intronic
1035838614 8:2786507-2786529 GGTTCCTGGCTTCTTGCTGCTGG - Intergenic
1036391498 8:8328092-8328114 GGCCACTGGCTTCCGGCAGCAGG - Exonic
1036626240 8:10474519-10474541 GGTCCCTGGCATGCTCCCCCTGG + Intergenic
1036915346 8:12799128-12799150 GCTGCCTGCCCTGCTGCAGCTGG - Intergenic
1037526564 8:19730310-19730332 GCTCCCTGGCTGGCTGCGGTGGG + Intronic
1037633415 8:20678453-20678475 AGCCTCTGGCTTACTGCAGCGGG - Intergenic
1037745550 8:21641310-21641332 GGTCCATGGATTCCTGAAGCTGG + Intergenic
1039082160 8:33744151-33744173 TGTCCCTGGTCTCCTGCAGCAGG - Intergenic
1039941844 8:42097988-42098010 GGTCCCTGGCTGGCAGAAGCTGG + Intergenic
1041033789 8:53766122-53766144 GGTCCCTGACTTCCCGCAACAGG - Intronic
1041133627 8:54732134-54732156 TGTGCATGGCTTGCAGCAGCAGG - Intergenic
1044021669 8:87112720-87112742 AGTCCCTGGCATGATGAAGCAGG - Intronic
1046924065 8:119767852-119767874 GGTCCCTGGCTTCTTGGGGCTGG - Intronic
1048044457 8:130759982-130760004 GGTCCCTGACTTCCCGCAACAGG - Intergenic
1048269819 8:133019604-133019626 GGTGCCTGGCTGCCAGCAGCTGG - Exonic
1048361782 8:133703649-133703671 GGCCACTGGTTTCCTGCAGCAGG + Intergenic
1056839369 9:89986195-89986217 GGTCCGTGGCTCTCTGCAGGTGG - Intergenic
1057029906 9:91767716-91767738 TGCCCCTGGTTTTCTGCAGCTGG - Intronic
1057538879 9:95945707-95945729 GGTCCCTGACTTCCCGCAACAGG + Intronic
1058120812 9:101136721-101136743 GTTACCTGGCTTGCAGCATCTGG + Intronic
1058881509 9:109289367-109289389 GGAAACTGGCTTGCTGCAGGTGG - Intronic
1059523228 9:114963541-114963563 GGTCCCTGACTTCCTGCAACAGG + Intergenic
1061531541 9:131217845-131217867 TGTCAGTGGCTGGCTGCAGCTGG + Intronic
1061903192 9:133683473-133683495 GGACCCCGGCCTGCTGGAGCTGG + Intronic
1062262896 9:135671733-135671755 GGTCCCTGGGCGTCTGCAGCCGG - Intergenic
1062517123 9:136942328-136942350 GGTCACCGGCTTCCAGCAGCAGG + Exonic
1062745751 9:138210966-138210988 GCTCCCTGTCTGGCCGCAGCAGG + Intergenic
1203521712 Un_GL000213v1:52399-52421 TGGCCCTGGGTTACTGCAGCTGG - Intergenic
1185781910 X:2855118-2855140 GTTCCATGGCGTGCTGTAGCAGG - Exonic
1190185723 X:48232199-48232221 GGTCCCTGACTTCCTGCAACTGG - Intronic
1190394863 X:49971630-49971652 TGTCCTTGGCCTGCTGCACCTGG + Intronic
1191033158 X:55997123-55997145 GGTCCCTGCCTGGCTGCACCAGG - Intergenic
1192475218 X:71435528-71435550 TGTCCCTGGCTTTCTGCTGAAGG - Intronic
1192585670 X:72316590-72316612 AGTTCCTGGCTGGCTGCAGCTGG - Intergenic
1193554280 X:82933452-82933474 GCTCTCTGCCTTGCTGTAGCAGG + Intergenic
1194467751 X:94254960-94254982 GTTTCCTGAATTGCTGCAGCTGG - Intergenic
1201343077 Y:12954726-12954748 GGTCCCTGACTTCCCGCAACAGG + Intergenic
1202191865 Y:22253922-22253944 GATCCCTGGCCTGCTGCCTCTGG - Intergenic