ID: 939184374

View in Genome Browser
Species Human (GRCh38)
Location 2:138843011-138843033
Sequence AGCCATATCCTACATTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939184371_939184374 -8 Left 939184371 2:138842996-138843018 CCACTAGGATTTTGTAGCCATAT No data
Right 939184374 2:138843011-138843033 AGCCATATCCTACATTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939184374 Original CRISPR AGCCATATCCTACATTGCTG GGG Intergenic
No off target data available for this crispr