ID: 939189707

View in Genome Browser
Species Human (GRCh38)
Location 2:138902033-138902055
Sequence AGAGCTGTGCCCAGGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 5, 2: 7, 3: 88, 4: 589}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939189707_939189713 19 Left 939189707 2:138902033-138902055 CCGCAGGGCCTGGGCACAGCTCT 0: 1
1: 5
2: 7
3: 88
4: 589
Right 939189713 2:138902075-138902097 TGCTACCACCGCTACCTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939189707 Original CRISPR AGAGCTGTGCCCAGGCCCTG CGG (reversed) Intergenic
900171660 1:1272361-1272383 GCAGCTGTGCCCAGGTGCTGAGG + Intronic
900186557 1:1335804-1335826 ACAGCTGTGCCCAGGCCCCCAGG - Exonic
900550020 1:3250033-3250055 AGCGCTGGGCCGTGGCCCTGGGG + Intronic
900602321 1:3508489-3508511 AGGGCTGTCCCCAGGTCTTGGGG + Intronic
900962983 1:5937529-5937551 AGAACTGGGCCCAGGGCCAGAGG - Intronic
901120913 1:6892991-6893013 AGAGCTGTGGCCGGGCGCGGTGG + Intronic
901145418 1:7061646-7061668 CCAGCTGTGCAAAGGCCCTGAGG + Intronic
901490566 1:9594414-9594436 GGAGATGGGACCAGGCCCTGCGG - Intronic
901506964 1:9690827-9690849 GTAGCTATGCCCAGGGCCTGGGG + Intronic
901781443 1:11597422-11597444 AGGGCTGTGGCCAGGCACAGTGG + Intergenic
902089680 1:13893216-13893238 AGAGCGCTGCCCAGGCCCCGCGG - Intergenic
902219789 1:14957706-14957728 ACAGCTCTGCGGAGGCCCTGAGG + Intronic
902554116 1:17236891-17236913 ACAGCTGTGCAAAGGCCCTGAGG + Intronic
902578334 1:17392520-17392542 AGAGCTGGGCCACTGCCCTGGGG + Intronic
902834119 1:19035798-19035820 TGAGCTGCGCCCTGGCTCTGGGG - Intergenic
903290809 1:22313205-22313227 AGAGCTGTGCACAGCTCTTGAGG + Intergenic
903671549 1:25038869-25038891 ATAGCCGTGCAAAGGCCCTGAGG + Intergenic
903808625 1:26022322-26022344 AGAGCAGTGCCCAGGGGCAGGGG + Exonic
903956158 1:27027484-27027506 AGAGCAGTCGCAAGGCCCTGAGG - Intergenic
904119911 1:28191182-28191204 AGAGATGTGGCCAGGCCTCGCGG + Intronic
904422610 1:30403923-30403945 GGAGCTGGCCCCAGGCACTGTGG - Intergenic
904974385 1:34444715-34444737 AGAGCTGAGCAAAGCCCCTGAGG + Intergenic
904979758 1:34488816-34488838 AGAGCTGAGTTCAGGTCCTGTGG - Intergenic
905177820 1:36149115-36149137 AGAGCTGCACTCAGGCCTTGGGG + Intronic
905231293 1:36516287-36516309 AGGGCTGGGCCCAGACCCTGGGG + Intergenic
905362678 1:37431243-37431265 GGAGCTGTGCCCTGGCCAGGTGG + Intergenic
905707632 1:40073750-40073772 AGAACTGTGCCCAGGCCCAAAGG - Exonic
905866097 1:41377582-41377604 AGAGCTGGGCCCAGCTTCTGGGG - Intronic
906035355 1:42747302-42747324 AGCGCTGTGCCATCGCCCTGTGG - Exonic
906096021 1:43224562-43224584 TGAGCTGTCCCCAGCCCATGGGG - Intronic
906100554 1:43257694-43257716 ACAGATGTTCCCAGGCCCTCAGG - Intronic
906144165 1:43550223-43550245 TGGGCTGTGCCCAAGGCCTGGGG - Intronic
906344504 1:45006736-45006758 AGAGCTGTGCCCTAGCTCAGCGG - Exonic
906401881 1:45510406-45510428 CGAGCTTTGGCCAGGCACTGTGG + Exonic
906637208 1:47417304-47417326 CGACCTGTGCCCCGGACCTGCGG + Exonic
906691524 1:47795919-47795941 AATGCTGTTCCCAGGCCATGTGG - Intronic
907105739 1:51880808-51880830 AGGGCTGTGCGCAGTCACTGAGG + Intergenic
907275130 1:53312741-53312763 AGAGCAGTGGCCAGGGCTTGGGG + Intronic
912333827 1:108844466-108844488 AGACCTTTGCCAAGGCCCAGTGG + Intronic
912473547 1:109922162-109922184 AGACATGTGCCCAGGACCAGAGG - Intronic
912587623 1:110780971-110780993 AGAACTGCGTCCAGGCCTTGGGG + Intergenic
912696927 1:111848885-111848907 AGAGGTGCCCCCAGCCCCTGTGG - Intronic
913255132 1:116945934-116945956 AGGCTTGTTCCCAGGCCCTGTGG + Intronic
914324561 1:146599220-146599242 AGACCTGTGGCCAGCACCTGTGG + Intergenic
914490424 1:148147642-148147664 AGAGCTGTGCCTGGTCCCTGCGG - Intronic
915299189 1:154942305-154942327 AGAGCTATCCCCAAGGCCTGTGG + Intergenic
915596066 1:156897203-156897225 AGAGAAGTGCCCTGTCCCTGGGG + Intronic
915693042 1:157709774-157709796 AGAGATGTCCACAGGCTCTGAGG - Intergenic
915954201 1:160209260-160209282 AGAGCTGTGCCCACAACCCGGGG + Intronic
916084926 1:161261563-161261585 AGAGATGTGTTCAGTCCCTGAGG + Intronic
917889947 1:179426120-179426142 AGAGCTTTGGCCAGGCGCAGTGG - Intronic
918114605 1:181485297-181485319 AGGGAGATGCCCAGGCCCTGGGG - Intronic
918225960 1:182483871-182483893 AGAGCTGTGCTCTGTCCCTCAGG - Intronic
919380651 1:196856406-196856428 ACATCTGTGCCCAAGCACTGGGG + Intronic
921390107 1:214607572-214607594 AGAGCTATGCCTGGTCCCTGCGG + Intronic
922958363 1:229624827-229624849 AGAGCTGTGACCAGGAACTGGGG + Intronic
923299788 1:232630299-232630321 TGCGCTGTTCCCAGGCCCCGCGG + Intergenic
923372505 1:233327765-233327787 ATGGTCGTGCCCAGGCCCTGCGG - Exonic
923568066 1:235091512-235091534 AGAGATGTGGCCAGGCGCAGTGG + Intergenic
924447788 1:244149953-244149975 AAAGCTGTGCCCAGGCTAGGCGG - Intergenic
924455655 1:244217061-244217083 AGTTCTGTTCCCAGGCCCTCAGG + Intergenic
924531598 1:244898527-244898549 AGTTCTGTGCACAGGGCCTGTGG - Intergenic
1062832108 10:612643-612665 TGAGCTGTGGCCGGGCCCTTTGG - Intronic
1063098188 10:2926668-2926690 ACATGTGTGCCCAGGACCTGGGG + Intergenic
1063200873 10:3784802-3784824 AGCGCGGGGCCCAGGCCCAGCGG + Intronic
1064340790 10:14483564-14483586 AGGGTTGTGCAAAGGCCCTGGGG + Intergenic
1064462196 10:15546028-15546050 CGAGCTGTGCAAAGGCCCTGAGG - Intronic
1065634087 10:27712659-27712681 ACTGCTGTGCCCAGGCACAGTGG + Intronic
1065943246 10:30583984-30584006 GGAGCTGTTCCCAGTCCCGGTGG + Intergenic
1067038016 10:42933475-42933497 AGAGCCGAGGGCAGGCCCTGGGG + Intergenic
1067046155 10:42986231-42986253 AGAGCTGTCCCCTGGCCAAGGGG + Intergenic
1067052135 10:43027780-43027802 AGAGCTGAGGCCCGGGCCTGAGG + Intergenic
1067187855 10:44045207-44045229 AGTGTTGTTCCCAGGCCCTGGGG + Intergenic
1067427991 10:46223802-46223824 AGGGCTGTGCCCAGGCCCTGTGG + Intergenic
1067436948 10:46284949-46284971 AGGGCTGTGCCCGGTGCCTGCGG + Intergenic
1068921393 10:62488478-62488500 AGAGTTGTGGCCAGGTGCTGTGG - Intronic
1069580487 10:69562844-69562866 AGGGTGGTGCCCAGACCCTGGGG + Intergenic
1069715186 10:70516007-70516029 AGGGCTGAGCCCAGTGCCTGTGG - Intronic
1069719177 10:70539078-70539100 CCTCCTGTGCCCAGGCCCTGGGG + Exonic
1070654588 10:78262577-78262599 AGGGCTGTGCCTGGGTCCTGTGG + Intergenic
1070778946 10:79126527-79126549 ACAGCTGGGCCAAGACCCTGTGG + Intronic
1071494165 10:86156319-86156341 TGAGCTGTGGCCAGTGCCTGGGG - Intronic
1071567972 10:86681294-86681316 AGTGCTGCGCCCAGGCGCTCTGG + Intronic
1072070331 10:91909031-91909053 AGAGCATTCCCCAGGACCTGCGG + Exonic
1072474896 10:95750735-95750757 AGAGTTGTGGCCAGGCGCGGTGG + Intronic
1072475229 10:95753706-95753728 AGAACTGTGGCTAGGCACTGTGG + Intronic
1073706554 10:105990218-105990240 AGACCTGTACTCAGGCCGTGTGG - Intergenic
1073761460 10:106632962-106632984 ACAGATGTGCAAAGGCCCTGTGG + Intronic
1074432910 10:113408859-113408881 TCAGCTGTGCCAAGGGCCTGTGG - Intergenic
1074519269 10:114202885-114202907 AGTGCTGTGCCCACTGCCTGTGG + Intronic
1074783823 10:116821321-116821343 AGGGCTGTGCTAAGGTCCTGAGG - Intergenic
1074792845 10:116909139-116909161 GGACCTGTCCCCAGACCCTGAGG - Intronic
1075021551 10:118956243-118956265 AGAGTTGGTCCCAGGGCCTGGGG - Intergenic
1075077489 10:119360800-119360822 TGCTCTGTTCCCAGGCCCTGTGG + Intronic
1075656101 10:124162292-124162314 GAACCTGTGCCCAGTCCCTGAGG + Intergenic
1075825779 10:125356194-125356216 AGAGGGGAGGCCAGGCCCTGGGG - Intergenic
1075977871 10:126712333-126712355 AGAACTGGGTCCAGGCCTTGGGG + Intergenic
1076488403 10:130839365-130839387 AGAAGTGTGCAAAGGCCCTGAGG - Intergenic
1076510071 10:131007046-131007068 AGTGCTGTGCCCAGGGCATGAGG - Intergenic
1076715902 10:132363565-132363587 AGAGCAGTGCTCATGCCCTGGGG - Intronic
1076719274 10:132386171-132386193 TGGGCTGTGCCCAGGGCCTGAGG - Intergenic
1076785271 10:132746519-132746541 ACACCTGTGCCCTGGGCCTGTGG + Intronic
1076997211 11:303983-304005 AGATCTGTGCCCTGGTCCCGAGG - Intergenic
1077116174 11:885587-885609 AGAGAAGGGCCCAGGCACTGAGG - Intronic
1077199429 11:1298027-1298049 TGGGCTGTGCCAGGGCCCTGTGG - Intronic
1077344571 11:2040301-2040323 AGCCCTGTGCCCAGGCCTTGGGG + Intergenic
1077484570 11:2832859-2832881 GGAGCCCTGGCCAGGCCCTGTGG - Intronic
1077556014 11:3226438-3226460 AGAGGTGGGTCCAGCCCCTGGGG + Intergenic
1078416031 11:11165520-11165542 AGAGCTGTTCCATGGCCCTCAGG - Intergenic
1078652822 11:13211862-13211884 AGTGCTCTGCAAAGGCCCTGTGG + Intergenic
1078883644 11:15478391-15478413 TGAGATGTGGCCAGGCCCTCAGG - Intergenic
1079090727 11:17478096-17478118 GAGGCTCTGCCCAGGCCCTGAGG + Intergenic
1079252555 11:18797546-18797568 AGAGCTGGGACAAGCCCCTGGGG + Intergenic
1080640430 11:34155339-34155361 AGCGCAGAGCCCAGGCCCGGAGG + Intronic
1081531603 11:43964155-43964177 AGGGCTGTGGCCAGGCGCGGTGG + Intergenic
1081813230 11:45924725-45924747 AGCCCTGAGCCCAGGTCCTGTGG + Intronic
1083399091 11:62411578-62411600 TGAGCTGTGCCCAGGCACAGAGG - Intronic
1083446022 11:62708529-62708551 AGAGCTGTCCCCAGGCCTCTGGG + Intronic
1083587492 11:63870851-63870873 AAAGCTGTGGCCAAGACCTGGGG + Intronic
1083976015 11:66120929-66120951 AGAGGCGTGCACAGGCCCTGTGG - Intronic
1083991210 11:66246842-66246864 AGAGCTGTCCACAGGCCAGGTGG - Intergenic
1084112362 11:67022530-67022552 GGCACTGTGCCCAGCCCCTGCGG + Intronic
1084500924 11:69534660-69534682 AGAGATGTGGCCAGGCGCAGTGG + Intergenic
1084658902 11:70535811-70535833 GGAGCTGGGCCCAGGCACTTGGG + Intronic
1084726399 11:70945254-70945276 ACAGCAGTGCAAAGGCCCTGGGG + Intronic
1084861092 11:72018704-72018726 AGAGCTCAGCCCTGGGCCTGTGG - Intronic
1084893675 11:72250177-72250199 AGGGCTGGGGCCAGGCCCTCGGG + Intergenic
1086342178 11:85857759-85857781 AAGGCTGTGCCCAGGCCCTGTGG + Intronic
1086917537 11:92547892-92547914 AGGGCTGTGCAGAGGCTCTGGGG + Intronic
1087142296 11:94776593-94776615 AGGGCTCTGCACACGCCCTGTGG + Intronic
1088543309 11:110935840-110935862 ACAGTTGTTCCCAGACCCTGGGG + Intergenic
1088829323 11:113521990-113522012 GCAGCAGTGCCCAGGCCCAGAGG + Intergenic
1088869814 11:113880928-113880950 AGAGATGTGTACAGGCCCTTTGG + Intergenic
1088921171 11:114260665-114260687 AGAGCTGGGCCCTGGCCTTGGGG + Intronic
1089466858 11:118691054-118691076 AGGGCCGTGCAGAGGCCCTGAGG - Intergenic
1089505543 11:118959556-118959578 ATAGTTGTGCAAAGGCCCTGAGG - Intergenic
1089588668 11:119526006-119526028 AGCGCCGTGCAAAGGCCCTGAGG - Intergenic
1089780920 11:120872696-120872718 AGTACTGTGCCAAGGCCCTGAGG - Intronic
1090711942 11:129394878-129394900 AGAGCTGTGCAAAGGCACCGAGG + Intronic
1202827557 11_KI270721v1_random:95490-95512 AGCCCTGTGCCCAGGCCTTGGGG + Intergenic
1091393926 12:142174-142196 AGAGCTCTTCCCAGGGCCTCCGG - Intronic
1091628614 12:2141361-2141383 TGAGCTCTGGCCAGGCCCTCTGG - Intronic
1091750617 12:3019404-3019426 AAAGCTGTGCTCAGGGCTTGTGG + Intronic
1092070064 12:5624915-5624937 AGAGCTCTCCCCAGCCCCTGGGG - Intronic
1092123288 12:6059004-6059026 AGAGCTGACCCTAGCCCCTGAGG - Intronic
1092241528 12:6839088-6839110 GGCGCTGTGCCCTGGCACTGTGG + Exonic
1092264490 12:6970476-6970498 AGGGCCGTGCCCATGCCCCGGGG + Exonic
1094322859 12:29204536-29204558 AGGCCTGTGCAAAGGCCCTGGGG + Intronic
1096514381 12:52148115-52148137 AGATCTGGCCCCAGGCCCTGTGG - Intergenic
1096869574 12:54584884-54584906 AGAGCTGGGGCCAGGACCAGGGG - Intronic
1097268828 12:57761758-57761780 AGAGCTGTGCCCAGCCTCTGGGG + Intergenic
1098281940 12:68870767-68870789 AGAGCTGAGCCCCAGACCTGTGG + Intronic
1099540726 12:83904469-83904491 AGAACTGTGTGCAGGCCCCGTGG + Intergenic
1101701086 12:107174654-107174676 GGGGCTGTGCCCAGGCGCTGAGG - Intergenic
1102201833 12:111062833-111062855 CGAGATGTGCGAAGGCCCTGGGG + Intronic
1102652406 12:114451513-114451535 ATGGCTGTCCCCAGGGCCTGTGG + Intergenic
1102798071 12:115706699-115706721 AGAGCTGTTCTCAGGGCCTTGGG - Intergenic
1103042994 12:117711355-117711377 AGACATGTGCAAAGGCCCTGAGG + Intronic
1103043533 12:117715926-117715948 AGACATGTGCAAAGGCCCTGAGG - Intronic
1103058781 12:117842370-117842392 AGGGCTGTGCAAAGGCCCTGGGG + Intronic
1103114857 12:118318441-118318463 AGAGTTGTGGCCAGGCGCAGCGG - Intronic
1103711207 12:122913971-122913993 AGAGTTATGCACAGGCCCAGAGG + Intergenic
1103923034 12:124409354-124409376 CGTGCTGTGCCCACGGCCTGGGG + Intronic
1103946618 12:124530966-124530988 ATAGCTGCCCCCAGGCCCCGAGG + Intronic
1103956867 12:124582273-124582295 GGAGCTGTACCCAGGGCCTGGGG - Intergenic
1104148866 12:126062416-126062438 ACAGCTGTGGCCAGGCACAGAGG + Intergenic
1104218471 12:126758274-126758296 ACAGCTGTTCCCAAGCCCTTGGG + Intergenic
1104386510 12:128355745-128355767 AGGGATGTGCAAAGGCCCTGAGG - Intronic
1104400417 12:128471485-128471507 AGAGCTATGCCTAGGGCCAGGGG - Intronic
1104663322 12:130628103-130628125 ACAGCCGTGCAAAGGCCCTGAGG - Intronic
1104822220 12:131683756-131683778 TGAGCTGGGCCCAGGCCTGGGGG + Intergenic
1104904569 12:132206245-132206267 CCACCTGTGCCAAGGCCCTGAGG - Intronic
1105391691 13:19985552-19985574 AGAGCTGTGGCCAGGCACAGTGG + Intronic
1108195711 13:47992940-47992962 AAATCTGTGCCCAGGCGCAGTGG + Intronic
1108903394 13:55440859-55440881 TGAGCTGTACCCAGGCCCTGTGG - Intergenic
1112155239 13:96809903-96809925 AGAGCTTGGCACAGGGCCTGGGG + Intronic
1112209429 13:97361138-97361160 ATAGCTTTGCCCAGACCCTCAGG - Intronic
1112337247 13:98525537-98525559 AGTGCTGAGTCCAGGGCCTGGGG - Intronic
1113366460 13:109681153-109681175 AGAGCTGTGAGCAGGACCAGTGG + Intergenic
1113684502 13:112272990-112273012 AGAGCTGTACCCCCGCTCTGGGG - Intergenic
1113788760 13:113016405-113016427 ACAGCTCTGCCAAGCCCCTGGGG + Intronic
1113911729 13:113844709-113844731 AAAGCTGTGGCCACGGCCTGTGG + Intronic
1114858100 14:26477000-26477022 AGAGGCGTGGCCAGGCACTGTGG - Intronic
1117341743 14:54797843-54797865 AGAGCTCTGCCCTGGTCCTCGGG + Intergenic
1117438492 14:55739988-55740010 CGCGCAGTGCCCAGCCCCTGGGG + Intergenic
1117687821 14:58273157-58273179 TGAGTTGTGGCCAGGCCCGGTGG - Intronic
1118390094 14:65288395-65288417 ACAGCTGTGGCCAGGCGCGGTGG + Intergenic
1118928414 14:70215499-70215521 AGAGCTTTGAACAGGCGCTGAGG + Intergenic
1119440004 14:74621819-74621841 AGAGATGTTCCCAAGCCCCGAGG - Intergenic
1121048355 14:90804046-90804068 AGAGCTGTGGCCGGGCGTTGTGG + Intronic
1121241942 14:92437268-92437290 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1122165394 14:99819601-99819623 AGATCTGTTCCTTGGCCCTGCGG + Intronic
1122806447 14:104262503-104262525 AGGTCTGCACCCAGGCCCTGGGG + Intergenic
1122838729 14:104444053-104444075 CCAGGTTTGCCCAGGCCCTGGGG + Intergenic
1123042753 14:105497066-105497088 AGAGCTGCCCCCCGGCTCTGAGG - Intronic
1123114840 14:105890019-105890041 TGGGCTGTGCCCTGGACCTGTGG + Intergenic
1123196968 14:106626392-106626414 AGAGATGTGCCCAGCCCCAGCGG + Intergenic
1202904551 14_GL000194v1_random:60663-60685 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic
1124351420 15:28958327-28958349 ATTACTGGGCCCAGGCCCTGTGG + Intronic
1124998728 15:34749435-34749457 ATAGCTGTGCACAGGCCAAGAGG + Intergenic
1125413682 15:39430565-39430587 AAAGCTTTCCCCAGCCCCTGCGG + Intergenic
1126069244 15:44851363-44851385 AGAGATGTACCCAGGCGCAGTGG + Intergenic
1128073692 15:64812997-64813019 AAAGCTGTGATCAGCCCCTGCGG + Intergenic
1128108846 15:65063564-65063586 AGGGCTGTGCCAAGGCACCGGGG + Intronic
1128632457 15:69280446-69280468 AGAGCTTAGCCCAGGCCTGGTGG + Intergenic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1128760829 15:70215068-70215090 AGAGCTAGGCCCAAGCCCAGGGG + Intergenic
1129847940 15:78776677-78776699 CCTGCTGTGACCAGGCCCTGGGG - Intronic
1131048017 15:89328503-89328525 AGTACTGTGCCCAGGACGTGTGG - Exonic
1131143808 15:89999490-89999512 AGACCTGGGCAAAGGCCCTGGGG + Intergenic
1131345755 15:91646771-91646793 AGGGCTGTGCCCAGGGGCTTAGG + Intergenic
1131767499 15:95695340-95695362 ATAGCTTTACCCAGGCCCAGGGG + Intergenic
1132270566 15:100520354-100520376 AGACCTATCCCAAGGCCCTGTGG - Intronic
1132367315 15:101266953-101266975 AGAGCAGTTACCAGGACCTGGGG - Intergenic
1132546605 16:536097-536119 TCACGTGTGCCCAGGCCCTGAGG + Exonic
1132590563 16:724583-724605 TGAGCAGTGCCGGGGCCCTGGGG + Intronic
1132610103 16:811476-811498 AGGGCTTTGGCCAGGCGCTGTGG + Intronic
1132678401 16:1130099-1130121 ACAGCTTTGCCCATTCCCTGCGG + Intergenic
1132709014 16:1258405-1258427 AGAGCTGTGCCCAGCCCAACCGG + Exonic
1132747856 16:1444392-1444414 AGAGCTGGGCACAGGCCAGGGGG + Exonic
1132762916 16:1519698-1519720 AAGGCTGTGCCCGGGCTCTGAGG + Intronic
1133031860 16:3014820-3014842 ATAGCTGGGACCTGGCCCTGGGG + Exonic
1133036048 16:3035046-3035068 AGAGCTGGGCCCAGTCCCCCTGG - Intronic
1133115707 16:3576955-3576977 AGAGATGTGGCCAGGCACGGTGG - Intronic
1133164372 16:3936164-3936186 ACACTTGTGCCCAGGCCCTCTGG - Intergenic
1133287081 16:4695505-4695527 AGAGCTGTGCGCCACCCCTGTGG - Exonic
1133295730 16:4751368-4751390 AGCCCTGGGCCCCGGCCCTGGGG + Exonic
1133967433 16:10541644-10541666 AGGGCTGTTCCCAGGGCCAGAGG + Intronic
1134689424 16:16181520-16181542 ACAGCAGTGCAAAGGCCCTGGGG + Intronic
1134827333 16:17295180-17295202 ACTGCTGTGCAAAGGCCCTGAGG + Intronic
1136070203 16:27782911-27782933 AGAGCACTGCTCAGGCTCTGGGG - Intergenic
1136142649 16:28297420-28297442 AGAGCTGTGCCCAGTGACAGGGG - Intronic
1136470069 16:30473988-30474010 AAAGCTCTTCCCAGGGCCTGAGG - Intronic
1136495799 16:30643222-30643244 AGACGTGTGGCCAGGCCCAGTGG + Intergenic
1136578117 16:31136187-31136209 AAAGCTGGGGCCAGGCCCTGGGG - Intergenic
1136922977 16:34346635-34346657 AGAGCTGGGCCCAGGCCCTGAGG + Intergenic
1136981596 16:35065171-35065193 AGAGCTGGGCCCAGGCCCTGAGG - Intergenic
1137323703 16:47411757-47411779 AGACCTGTTCCCAGGCCGTATGG - Intronic
1137580918 16:49632980-49633002 ACAGCTGTGCTCAGGCTGTGGGG - Intronic
1137731493 16:50693666-50693688 AGTGCTGTGCCCAGCGCCTGGGG + Intronic
1138375444 16:56560627-56560649 AGAGATGTGCAAAGGCCCTGGGG + Intergenic
1138457121 16:57127585-57127607 GAAGCTGTGCCCAGGCCCATTGG + Intronic
1138552887 16:57756977-57756999 GGGGCTGAGGCCAGGCCCTGTGG - Exonic
1139891046 16:70253493-70253515 GGGGCTGTGCCCAGGGCCTGTGG + Intronic
1139954665 16:70687311-70687333 AGTGCAGGGACCAGGCCCTGGGG + Intergenic
1140009002 16:71111627-71111649 AGACCTGTGGCCAGCACCTGTGG - Intronic
1140050576 16:71477696-71477718 AGAGCTGAGCACAGGGCGTGAGG - Intronic
1140364005 16:74367817-74367839 GGAGCGGTGCGCAGGCCCAGGGG + Intergenic
1140483345 16:75274870-75274892 AGAGCAGTGCAAAGGCCCTGGGG - Intergenic
1141092747 16:81141362-81141384 ACAGCCATGCCCAGGCCCTCAGG - Intergenic
1141478317 16:84288762-84288784 GGGGCTGTGCAAAGGCCCTGGGG + Intergenic
1142113475 16:88344481-88344503 AGTGCTGGGCACAGGGCCTGAGG + Intergenic
1142141046 16:88473017-88473039 AGGTCTGGGCGCAGGCCCTGCGG + Intronic
1142223484 16:88866326-88866348 ACAGCTGTGTGGAGGCCCTGGGG - Intronic
1142685991 17:1577239-1577261 TCAGCTGTGCCCAGGGCCTGTGG + Intronic
1142813473 17:2407606-2407628 GGAGCTGAGCCCTGGCTCTGTGG - Intronic
1142866640 17:2795373-2795395 AGAGATGAGCACTGGCCCTGTGG + Intronic
1143020878 17:3916694-3916716 GGAGCTCTGGCCAGGGCCTGGGG + Intergenic
1143116058 17:4582435-4582457 AGCTCTGTTCCCAGGCCCAGGGG - Intergenic
1143168468 17:4911397-4911419 AGTGCTTAGCCCTGGCCCTGGGG - Intergenic
1143331271 17:6137717-6137739 AGAGCTGTGCCCAGGCCAACAGG + Intergenic
1143479871 17:7222020-7222042 TCTGCTGTGCCCAGCCCCTGTGG + Exonic
1143768131 17:9150899-9150921 AAAGCACAGCCCAGGCCCTGTGG - Intronic
1143907419 17:10220303-10220325 AGAGCAGTGCCTAGGTCCAGAGG + Intergenic
1144852589 17:18251550-18251572 ACAGCTGTGCAAAGGCCCTGAGG - Intronic
1144998683 17:19288550-19288572 GCAGCTGTGCAAAGGCCCTGAGG + Intronic
1145041413 17:19580393-19580415 AGCGGTGTCCCCAGGCGCTGTGG + Intergenic
1145191017 17:20842245-20842267 AGAGCTGTGCCTGGTCCCTGCGG - Intronic
1145814058 17:27782845-27782867 AGAGCTGTGCCCAGGCCTCCTGG - Intronic
1146227959 17:31083688-31083710 ATAGCTGTGGCCAGGCGCGGTGG + Intergenic
1146907081 17:36624718-36624740 AGACTTGTGTCCCGGCCCTGGGG + Intergenic
1147317135 17:39626467-39626489 AGGGGTGTGCCGGGGCCCTGTGG - Intergenic
1147808705 17:43151055-43151077 AGACCTCTGCAAAGGCCCTGAGG - Intergenic
1147987918 17:44316765-44316787 AGGGCTGAGGCAAGGCCCTGAGG + Intronic
1148480501 17:47956939-47956961 AGGGCTGGGCCCTTGCCCTGGGG + Intronic
1149511124 17:57242632-57242654 AGAGCTGTGGCCAGCCACTGGGG + Intergenic
1149998217 17:61416070-61416092 AGAGGTCTGCCCTGGCCTTGGGG - Intergenic
1150109161 17:62482900-62482922 AGAGCTGTGACAAGGTGCTGTGG + Intronic
1150132825 17:62678535-62678557 AGAGCTGGGTCCAGGCCCAGGGG + Exonic
1150336472 17:64334221-64334243 AGAGCTGGGCGCTGGCCCGGGGG - Intronic
1150696920 17:67413533-67413555 GCTGCTGTGCCCGGGCCCTGAGG + Intronic
1150751327 17:67865371-67865393 ACTGGTGTGCCCAGGCACTGTGG + Intronic
1151304090 17:73251832-73251854 AGAACTGTGCTCAGTCCCTATGG - Intronic
1151571049 17:74925472-74925494 CGAGCTGAGGACAGGCCCTGAGG - Intronic
1151662676 17:75526837-75526859 AGAGCTGTGGCCCAGCCCGGGGG + Intronic
1152045396 17:77931690-77931712 AGAGGCGGGTCCAGGCCCTGAGG + Intergenic
1152392152 17:80009471-80009493 AGAGTTGGGCCCGTGCCCTGCGG - Intronic
1152504775 17:80741581-80741603 AGAGCTCTGCTCAGGCAATGTGG + Intronic
1152556034 17:81053794-81053816 AGAACTGCGCCCGGGCCCCGTGG + Intronic
1152556049 17:81053842-81053864 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556064 17:81053890-81053912 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556079 17:81053938-81053960 AGAACTGTGCCCGGGCCCCTTGG + Intronic
1152556093 17:81053986-81054008 AGAACTGTGCCCTGGCCCCAAGG + Intronic
1152556107 17:81054033-81054055 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556121 17:81054081-81054103 AGAACTGTGCCCTGGCCCCAAGG + Intronic
1152556134 17:81054128-81054150 AGAACTGTGCCCGGACCCCGTGG + Intronic
1152556149 17:81054176-81054198 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556164 17:81054224-81054246 AGAACTGTGCCCGGGCCCCTTGG + Intronic
1152556178 17:81054272-81054294 AGAACTGTGCCCTGGCCCCAAGG + Intronic
1152556192 17:81054319-81054341 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152740484 17:82016382-82016404 GGAGCTGGGGCCTGGCCCTGGGG + Intronic
1153567315 18:6431272-6431294 AGAGATTTGGCCAGGCACTGTGG - Intergenic
1153642319 18:7167718-7167740 AGGGAGGTCCCCAGGCCCTGTGG + Intergenic
1153688578 18:7568550-7568572 AGGGCCGTGGCCAGGGCCTGGGG - Intronic
1154201938 18:12306292-12306314 AGAACTGTCCCCATGTCCTGGGG + Intergenic
1154411070 18:14142641-14142663 AAAGCTGTGCAGAGGCCCTGGGG - Intergenic
1155067235 18:22278521-22278543 ATAGCTGAGCCCAGGCCCAGTGG + Intergenic
1156375685 18:36513391-36513413 GCAGCTGTGCCCAGGCACTGAGG + Intronic
1156405082 18:36775803-36775825 AGAACTGTCACCAGGGCCTGGGG + Intronic
1156470054 18:37371772-37371794 TAAGCAGTGCCCAGGCCCTGGGG + Intronic
1158688126 18:59633076-59633098 AGAGCTGTGCCCAGGGAAGGAGG - Intronic
1158876595 18:61739850-61739872 AGAGGTGTGGCCAGGCGCGGTGG - Intergenic
1159796101 18:72846215-72846237 AGAGATGCGGCCAGGCGCTGTGG + Intronic
1160218594 18:76956189-76956211 ACAGCTGTGCCCTGGCACAGTGG - Intronic
1160695952 19:484660-484682 ACCGCTGTGCAAAGGCCCTGGGG + Intergenic
1160743386 19:698278-698300 AAAGCTGTTTCCAGGGCCTGGGG + Intergenic
1160771089 19:831586-831608 AGAGCCATGCAAAGGCCCTGGGG + Intronic
1160772255 19:837847-837869 AGAGCTGTGGCCGGGCGCGGTGG - Intergenic
1160802613 19:977275-977297 ACAGCTGTGTGAAGGCCCTGAGG - Intergenic
1160980892 19:1816138-1816160 GGAGCTGTGCCCATCCACTGCGG + Exonic
1160995184 19:1879178-1879200 AGAGCTGTGCCTGGTCCCTGTGG + Intronic
1161016511 19:1986253-1986275 AGGCCAGTGGCCAGGCCCTGTGG - Exonic
1161026228 19:2038598-2038620 AGAGCTGAGCCCAGACCCCGGGG - Exonic
1161076590 19:2288739-2288761 AGACCTGAGCCCAGGCCCCGAGG + Intronic
1161262499 19:3345595-3345617 AGGTCTGTGCAAAGGCCCTGGGG - Intergenic
1161457381 19:4376337-4376359 AGAGCTGTGAGCGGGCGCTGAGG - Intronic
1161457609 19:4377367-4377389 AGAGCTGTGAGCGGGCACTGAGG + Intronic
1161513004 19:4682290-4682312 TGAGCTGGTCCCTGGCCCTGTGG + Intronic
1161704458 19:5812619-5812641 TGGGGTGGGCCCAGGCCCTGGGG + Intergenic
1161706049 19:5822302-5822324 TGAGCCGAGCCCAGGCCCGGAGG + Intergenic
1162068628 19:8140707-8140729 AGAGCTGCTCACAGACCCTGTGG - Intronic
1162103753 19:8357040-8357062 ACAGCTGTGGCCAGGCACAGTGG + Intronic
1162340975 19:10091470-10091492 CCATCTGTGCCCAGCCCCTGGGG - Exonic
1162460269 19:10810529-10810551 CGATCAGTGCCCTGGCCCTGTGG + Intronic
1162971276 19:14182787-14182809 GGGGCAGTGCCAAGGCCCTGGGG + Intronic
1163044028 19:14625909-14625931 AGAGCGGTTTCCAGGGCCTGGGG + Intronic
1163414471 19:17177723-17177745 AGCCCTGTGGCCAGGCCCTGGGG - Intronic
1164562034 19:29299237-29299259 AGAGCCATTCCCAGGCCCTCAGG + Intergenic
1164959587 19:32416404-32416426 AGAGCTGTGCCCTCATCCTGTGG - Intronic
1165096176 19:33411080-33411102 GGAGATGTGGGCAGGCCCTGCGG - Intronic
1165217403 19:34286042-34286064 AGAGTTGTGGCCAGGCACAGTGG + Intronic
1165365071 19:35360235-35360257 AGAGCAGTGCCCAGGGTCTGAGG + Exonic
1165921091 19:39298228-39298250 ACAGCAGGGCCCAGGCCCCGGGG + Exonic
1166411812 19:42560566-42560588 AATGCTGTGGGCAGGCCCTGGGG + Intronic
1166561997 19:43739038-43739060 AGAGCAGAGCCCTGGCTCTGGGG - Intronic
1166784468 19:45359375-45359397 AGATCTGGGCCCTTGCCCTGGGG - Intronic
1166894710 19:46016222-46016244 AGGTCTGTGCCCCTGCCCTGCGG + Exonic
1166946905 19:46402956-46402978 ACAGCAGTGCAAAGGCCCTGAGG - Intergenic
1166959873 19:46490939-46490961 AGAGCAGTGCAAAGGCCATGAGG + Intronic
1167117328 19:47495890-47495912 ACTGCTGTGCCCTGTCCCTGGGG - Intronic
1167458184 19:49609668-49609690 ACAGCTGTGCAAAGGCCCTGTGG + Intronic
1167469636 19:49668384-49668406 AGAGCTGGGGCCAGGCGCAGTGG - Intronic
1167687271 19:50964163-50964185 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1167765472 19:51479538-51479560 AGATATGTGCCCAGACTCTGAGG + Intronic
1168244079 19:55101677-55101699 AGTGATGTGCCCAGGCCTGGAGG - Intronic
1168630865 19:57955104-57955126 AGAGCCATGCCCAGCCCTTGAGG - Intergenic
926356604 2:12046537-12046559 AGTGCAGTGCCCAGGACCTATGG + Intergenic
926839673 2:17065690-17065712 AAAGCTGTGGCCGGGCGCTGGGG - Intergenic
927135482 2:20093504-20093526 AGGACTGTGCCCAGGCTGTGGGG + Intergenic
927491880 2:23526302-23526324 AGAGCTGTGGTCAGGGCATGCGG + Intronic
927754275 2:25696360-25696382 AGAGCTGAGGCCAGGCACGGTGG + Intergenic
927864427 2:26579608-26579630 AGAGCTTTCCGCAGGCCCTCAGG - Intergenic
928101030 2:28437471-28437493 AGAGCTGGGCGCTGGCCCTCGGG - Intergenic
928823601 2:35392086-35392108 GTAGCTGAGCCCAGGCACTGTGG - Intergenic
929484640 2:42342635-42342657 AGACCTGTGCTTTGGCCCTGAGG + Intronic
931786860 2:65627563-65627585 AGAACTGTGGCCAGGCGCAGTGG - Intergenic
932594793 2:73087185-73087207 AGGGCTGGCCCCAGGCCCTTGGG + Intronic
932687784 2:73887806-73887828 AGAGCTGTTGCCAGGGGCTGGGG + Intergenic
934135972 2:88996803-88996825 AGCCCTGTGGCCAGGGCCTGTGG - Intergenic
934220346 2:90076494-90076516 AGCCCTGTGGCCAGGGCCTGTGG + Intergenic
934278356 2:91590609-91590631 CCACTTGTGCCCAGGCCCTGAGG - Intergenic
934502086 2:94869732-94869754 AGAGCTGGGCTCTGGCCCAGAGG + Intergenic
935545448 2:104395590-104395612 AGGGCTGTGCCCAGGCCCTGTGG - Intergenic
935584828 2:104791252-104791274 AGAGCAGTGCCCAGTGCCTCTGG + Intergenic
936093358 2:109514822-109514844 ACCGCCGTGCCCAGGGCCTGGGG - Intergenic
936151134 2:110023069-110023091 TGGGCTGTCCCCAGGCTCTGAGG + Intergenic
936193541 2:110348300-110348322 TGGGCTGTCCCCAGGCTCTGAGG - Intergenic
936428396 2:112437485-112437507 AGCCCTGAGACCAGGCCCTGTGG - Intergenic
937153910 2:119704894-119704916 GGTTCTGTGCCCAGGTCCTGTGG + Intergenic
937316807 2:120936896-120936918 TGAGCAGTGCCCTGCCCCTGAGG + Intronic
937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG + Intergenic
937873864 2:126805379-126805401 ACAGCTGGGACCAGGCCCAGTGG - Intergenic
937914421 2:127092044-127092066 AGAGCTGGGCCAAGAGCCTGGGG - Intronic
937928735 2:127188292-127188314 AGAGCTGTGATCACGCCATGGGG - Intronic
938077723 2:128348834-128348856 AGCTCTGTGCCCAGGTCCTGAGG + Intergenic
938941738 2:136175692-136175714 AGAGCTCAGCCCAGCTCCTGGGG + Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
940072882 2:149709215-149709237 AGAGTAGTGCCCAAGCACTGTGG - Intergenic
941818480 2:169822303-169822325 AAAACTGTGCCCAGTCTCTGAGG + Intronic
942000175 2:171638656-171638678 AAAGCAGTGCCCTGGCCCAGTGG + Intergenic
942182208 2:173390662-173390684 AGAGCAGTGCCCAGCCCGGGAGG - Intergenic
942980043 2:182069994-182070016 AAAGCAGAGCCCTGGCCCTGTGG + Intronic
943184098 2:184583649-184583671 AGAGTGGTGCCCAGGGTCTGGGG + Intergenic
944062406 2:195583384-195583406 AGGACTGTGCCCAGGCCCTCAGG - Intronic
945275616 2:207984666-207984688 AGAAATGTGCCCAGGCGCAGTGG - Intronic
946193691 2:218021165-218021187 AGAGCTCTGCACAGCCCTTGGGG + Intergenic
946231973 2:218297087-218297109 AGGGCCGTGCCCAGGCCTAGGGG - Intronic
947586495 2:231360103-231360125 ACATCTGTTCCCAGGCCCTTGGG + Intronic
947723561 2:232383035-232383057 ACAGCAGTGCCAAGGCCCTGGGG + Intergenic
947861834 2:233366033-233366055 AGAGGTATGCAAAGGCCCTGTGG + Intronic
948117926 2:235507381-235507403 AGAGCTGTGCCCCAGTCCAGCGG - Intronic
948220517 2:236265800-236265822 GGCACTGTGCCCAGCCCCTGGGG + Intergenic
948382662 2:237561595-237561617 AAAGCTGCCCCCAGGTCCTGGGG + Intergenic
948696686 2:239736427-239736449 AGAGCAGGGCTCAGGCCCAGGGG - Intergenic
948704109 2:239778662-239778684 AGTGCTGTTCCCAGGCCCCGAGG - Intronic
948787764 2:240361868-240361890 AGAGATGTGTGCAGGCCCAGTGG + Intergenic
948851716 2:240711526-240711548 GGAGCTGAGCCCCGGCCTTGGGG - Intergenic
948851768 2:240711764-240711786 AATGCTGAGTCCAGGCCCTGGGG - Intergenic
1168881787 20:1212378-1212400 GGAGCTGTCCCCATGACCTGGGG - Intergenic
1169114036 20:3051292-3051314 AGAGCTGTGGCCGGGCGCGGTGG + Intergenic
1169211855 20:3770250-3770272 CGAGTAGTGCCCAGGCTCTGGGG + Intergenic
1169279670 20:4256353-4256375 AGAACTGTACCCAGGCCCAGCGG + Intergenic
1169547437 20:6664828-6664850 AGAGCTGAATCCAGTCCCTGGGG - Intergenic
1171419162 20:25006372-25006394 AAAGCTGTGCCCTGGGCATGGGG - Exonic
1172357582 20:34290798-34290820 AGGGCTGTGCCCAGGCCCTGCGG - Exonic
1172691294 20:36792218-36792240 AGAGATGTGGCCAGGCGCGGTGG + Intronic
1173005108 20:39134267-39134289 AGATATATGCCCAGGCCCTCAGG + Intergenic
1173202026 20:40961348-40961370 CGAGCTGTGGCCCTGCCCTGGGG - Intergenic
1173245516 20:41335059-41335081 AGAACTGTGCACAGCCACTGGGG - Intergenic
1173671595 20:44802902-44802924 ATAACTGTGCAAAGGCCCTGAGG - Intronic
1173843983 20:46176703-46176725 AGAGCTGGGGACAGGCCCGGAGG + Intronic
1173929064 20:46803510-46803532 AGAGCTTCTCCCAGGGCCTGTGG + Intergenic
1175207418 20:57322022-57322044 GGAGCTATGCAAAGGCCCTGCGG - Intergenic
1175460677 20:59149855-59149877 AAATCTGAGCCGAGGCCCTGAGG + Intergenic
1175918121 20:62436999-62437021 GCAGCTGTGCAAAGGCCCTGGGG - Intergenic
1176104266 20:63378318-63378340 ACAGCTGTGGCCCAGCCCTGGGG + Intronic
1176364995 21:6027395-6027417 GGTTCTGTGTCCAGGCCCTGTGG + Intergenic
1176373855 21:6077726-6077748 AGCCCTGAGACCAGGCCCTGTGG + Intergenic
1176623921 21:9075430-9075452 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic
1176861985 21:14015774-14015796 AAAGCTGTGCAGAGGACCTGGGG + Intergenic
1179648124 21:42788024-42788046 ACAGCTGAGGCCAGGCACTGTGG + Intergenic
1179749622 21:43460517-43460539 AGCCCTGAGACCAGGCCCTGTGG - Intergenic
1179758523 21:43511150-43511172 GGTTCTGTGTCCAGGCCCTGTGG - Intergenic
1179879722 21:44288374-44288396 AGAGCTGTGGCCATGTCCTCCGG + Exonic
1180076161 21:45464167-45464189 AGCACAGTGCCCAGGCACTGGGG + Intronic
1180161317 21:45999814-45999836 AGAGCTGGTGCCAGGCCCTAGGG + Intronic
1181308964 22:21933453-21933475 AGAGCTGCCCACAGACCCTGAGG - Exonic
1181313563 22:21958242-21958264 ACACCTGTGCCCAGGTCCTGAGG + Intronic
1181346671 22:22224314-22224336 ACACCTGCGCCCAGGTCCTGAGG + Intergenic
1181424189 22:22822448-22822470 CGAGGTGTGCCCAGGCCTGGAGG + Intronic
1181440510 22:22933124-22933146 AGGGGTGAACCCAGGCCCTGAGG - Intergenic
1181523228 22:23461013-23461035 AGAGCTGGGGCCCGGCCTTGAGG - Intergenic
1181733440 22:24864026-24864048 AGAGCTCTGGCCAGGCACAGTGG - Intronic
1181835760 22:25606713-25606735 AGGGCAGTTCCCAAGCCCTGTGG - Intronic
1181920869 22:26319551-26319573 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1181971427 22:26693324-26693346 ATGGATGTGCACAGGCCCTGGGG - Intergenic
1181997408 22:26893658-26893680 TGAGTTCTTCCCAGGCCCTGGGG + Intergenic
1182497311 22:30718663-30718685 ACAGCAGTGCCCAGGGCCTGTGG - Intronic
1183414305 22:37673748-37673770 AGCCCTGTGCCCAGCCCATGAGG + Intergenic
1183569095 22:38638857-38638879 ACAGCTGTGGACAGACCCTGTGG - Intronic
1184043281 22:41957116-41957138 AGAGCTATCCCCACGCCATGGGG - Intergenic
1184318488 22:43719134-43719156 AGGTCTGTGCACACGCCCTGTGG + Intronic
1184761471 22:46547181-46547203 GGACCTGTCCTCAGGCCCTGGGG - Intergenic
1184762420 22:46552031-46552053 AGAGCTGAGCCCAGGAGCTCTGG - Intergenic
1184803535 22:46776958-46776980 AGAGCTGAGGCCAAACCCTGGGG + Intronic
1185067584 22:48639849-48639871 AGAGCCCTGCCCAGACCCTGGGG - Intronic
1185326455 22:50228073-50228095 GCAGCCGTGCCCAGGGCCTGAGG + Intronic
1185367156 22:50441947-50441969 ACAGCTGTGCAAAGACCCTGAGG + Intronic
950145525 3:10647158-10647180 TGAGCTGTGTCCAGCCCATGGGG + Intronic
950447192 3:13045133-13045155 ACAGCGGTGCAGAGGCCCTGGGG - Intronic
950498360 3:13347974-13347996 AGAGCAGTTCGCAGGGCCTGTGG + Intronic
950675416 3:14551427-14551449 AGAGTGGAGCCCAGGGCCTGGGG - Intergenic
951809372 3:26682691-26682713 GGAGCTGTGCAGAGGCCCAGTGG - Intronic
952411590 3:33054455-33054477 AGATATGTGTCCAGGCCCTGGGG - Intronic
953236376 3:41111109-41111131 AGAGCTCTGCCCAGACCCCAGGG + Intergenic
953476859 3:43212542-43212564 AGAGCTGGGCCCTGGCACAGTGG + Intergenic
953766952 3:45750291-45750313 AGAGTTGTGCCCTGGCTCTGGGG - Intergenic
954258805 3:49424194-49424216 AGACACGTGCCCAGGCCCTATGG + Exonic
954406571 3:50348573-50348595 AGAGCTGTGCTCAGCTTCTGAGG + Intronic
954459770 3:50619667-50619689 TGAGCTCTGACCAGCCCCTGTGG + Intronic
954541913 3:51399041-51399063 GGAACTGTGTCCAGGCCCTTAGG - Intronic
954652682 3:52174992-52175014 ATAGCTGTGCAAAGGCCCTGAGG - Intergenic
955070287 3:55567300-55567322 AGACCTGCGCAAAGGCCCTGAGG + Intronic
955344919 3:58153679-58153701 AGAGTTGAGCCCAGGCAGTGTGG + Intronic
955353953 3:58215189-58215211 ACAGCTGTGCCAAGGCCCTGAGG - Intergenic
956030312 3:65030198-65030220 AGAGCTGTGCAAAGGCCCTGTGG + Intergenic
956997518 3:74844647-74844669 ACAGCAGTTCACAGGCCCTGGGG + Intergenic
959752658 3:109856545-109856567 AAAACTGTGTCCATGCCCTGAGG - Intergenic
959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG + Intronic
960672664 3:120167793-120167815 AGATCTGGGCCTGGGCCCTGAGG - Exonic
960969655 3:123130437-123130459 AGAGCTCAGAGCAGGCCCTGGGG - Intronic
961754791 3:129121462-129121484 AGGGCCGGGCCCAGGCCCGGGGG - Exonic
962256222 3:133871930-133871952 AGAGCTGGGCTCAGGGCCTAGGG + Intronic
962283100 3:134066711-134066733 GTAGCTGGGCCCAGGCACTGGGG + Intronic
962302373 3:134253662-134253684 ACAGCAGTGCAAAGGCCCTGAGG - Intergenic
962849170 3:139295100-139295122 AGCGCTGAGCCCTGGCCCAGAGG + Intronic
962956810 3:140274286-140274308 AGAGCTCTTCCCAGGCACTCAGG - Intronic
963826360 3:149958533-149958555 AAAGCTGTGCCAAGGCTCTAAGG - Intronic
965347147 3:167565658-167565680 ACAGCAGTGCAAAGGCCCTGAGG + Intronic
966426222 3:179782576-179782598 AGGGCAGTGCTCAGGCCATGTGG + Intronic
966906228 3:184527795-184527817 AGAGATGTGGCCGGGCCCAGTGG - Intronic
966933454 3:184690636-184690658 TGAGCTGTGCCCAGACCTGGAGG - Intergenic
967243024 3:187459751-187459773 AGGGCAGTGCCCAGGCCCAGAGG + Intergenic
968547212 4:1205472-1205494 AGAGCCGTGCCCAGCACCTGGGG + Intronic
968591912 4:1463769-1463791 TGTGCTGTGGGCAGGCCCTGGGG + Intergenic
968657288 4:1784088-1784110 AGAGCTGTGCCTTGGCCTTGAGG - Intergenic
968657527 4:1785170-1785192 TGAGGCCTGCCCAGGCCCTGTGG - Intergenic
968813586 4:2810746-2810768 AGAGGAGGGACCAGGCCCTGTGG - Intronic
968903077 4:3440229-3440251 GGGCCTGTGCCAAGGCCCTGGGG + Intergenic
968977990 4:3831635-3831657 CAAGCTGTGCCAAGGCCCAGCGG - Intergenic
969310725 4:6351774-6351796 AGAGCCGTGCCCAGAACCTCTGG + Intronic
969597874 4:8159079-8159101 AGAGCTGTCGCCACGGCCTGAGG + Intergenic
969612708 4:8236152-8236174 ACAGCTGTGTCGAGGCCCAGGGG + Intronic
969718085 4:8877963-8877985 GGTGCTGGGGCCAGGCCCTGGGG - Intergenic
969822029 4:9728064-9728086 GGAGCAGAGGCCAGGCCCTGTGG + Intergenic
970561495 4:17285914-17285936 AGATATGTGCAAAGGCCCTGAGG + Intergenic
970581420 4:17477443-17477465 AGAGCCGTGGGCAGGCCCTGGGG + Intronic
970885766 4:20986035-20986057 GGAGCTGAGCCCAGTCCCTGGGG + Intronic
971888366 4:32483180-32483202 AGAGCTCTCACCAGGCCATGAGG + Intergenic
972796979 4:42430873-42430895 AGTGTTGTGACCAGGACCTGTGG - Intronic
973250986 4:48059680-48059702 AGAGCAGTGGCTAGGACCTGGGG + Intergenic
973579997 4:52333797-52333819 AGAGAAGTGGCCAGGCGCTGTGG - Intergenic
973919735 4:55673115-55673137 CTAGATCTGCCCAGGCCCTGAGG - Intergenic
976706259 4:88022793-88022815 AGAGGTTTGGCCAGGCACTGTGG + Intronic
977163344 4:93664138-93664160 ACAGCAGTGCAAAGGCCCTGAGG + Intronic
977848107 4:101790681-101790703 AGAGCGGAGCCCTGGCCTTGCGG + Exonic
979970407 4:127127854-127127876 AGACCTGTGGCCAGGCGCGGTGG + Intergenic
980109964 4:128626014-128626036 AGGGCTGTGGCCAGGCACTGTGG + Intergenic
982234872 4:153242987-153243009 AGAGAGCTGCCCGGGCCCTGGGG - Intronic
982869963 4:160566573-160566595 AGAGCTGGGCCCAGGGCCATTGG + Intergenic
983587994 4:169376124-169376146 AGGGCTGTGCCCTGCCCCTCTGG + Intergenic
984998068 4:185455594-185455616 AGAGCTTTGGCCAGGCGCGGTGG + Intronic
985515353 5:341300-341322 AGAGCTGAGGCCAGGCGCAGTGG - Intronic
985570047 5:639845-639867 AGAGCCGTGCCCAGGGTCTGCGG - Intronic
985673643 5:1219208-1219230 AGAGCTGTTCACACGCCCGGGGG - Intronic
985673664 5:1219294-1219316 AGAGCTGTTCACACGCCCGGGGG - Intronic
985678841 5:1245694-1245716 AGAGCAGTGGCCAGGCCGTGTGG - Intronic
985705668 5:1400189-1400211 TGGGCTGTGCCCTGGGCCTGTGG - Intronic
985999569 5:3619927-3619949 AGAGAGCTGCCCAGCCCCTGTGG + Intergenic
986152350 5:5139789-5139811 ACAGCTGTGCCCGGGCACAGAGG + Intergenic
986187568 5:5459158-5459180 TGAGCTGTGGCCAGGCGCGGTGG - Intronic
986358257 5:6949862-6949884 AGAGCCTTGCCCAGGCAATGTGG - Intergenic
986718479 5:10540968-10540990 AGAGCAGTGGACAGGCCCTAGGG - Intergenic
986818945 5:11444833-11444855 TGAGCTGTGCTGAGGTCCTGTGG + Intronic
990282588 5:54267376-54267398 AGAGCTCTGGCCAGGCGCGGTGG - Intronic
991491749 5:67190596-67190618 AGAGCTGTGGCAAGGCCACGTGG + Intronic
992299268 5:75361550-75361572 AGAACTGTGCCTAGTTCCTGTGG + Exonic
993022274 5:82605777-82605799 AGCACTCTGCCAAGGCCCTGGGG + Intergenic
994321827 5:98403648-98403670 AGAGGTGTGGCCAGGCGCGGTGG + Intergenic
995387298 5:111602066-111602088 AGAACTGTGCCAAAGTCCTGAGG - Intergenic
996234422 5:121108607-121108629 AGAGCTGAGCAGAGGCCCGGCGG - Intergenic
997595969 5:135107680-135107702 AGAGCACTGCCCTGGCTCTGGGG + Intronic
998107990 5:139480882-139480904 TCAGCTGGGGCCAGGCCCTGTGG + Exonic
998369891 5:141654148-141654170 AGAGCAGTCCCCAGGCACGGGGG - Exonic
999171808 5:149601803-149601825 ATAGTTGTGCAAAGGCCCTGAGG + Intronic
1000084636 5:157878776-157878798 AGAGATGGGGCCAGGCGCTGTGG - Intergenic
1000249411 5:159479800-159479822 AGAGCTTTGGTCAGACCCTGTGG + Intergenic
1000365808 5:160489883-160489905 AGAGCTATGGCCAGGCACAGTGG - Intergenic
1001016200 5:168143543-168143565 AGTTCTGCGCCCAGGCACTGGGG - Intronic
1001265271 5:170269510-170269532 ATGGCTGTGCAAAGGCCCTGAGG - Intronic
1001269897 5:170303107-170303129 AGAGCTGTGTCCAGGCCTGGGGG - Intergenic
1001576513 5:172767979-172768001 AGATCTGATCCCATGCCCTGTGG - Intergenic
1001586729 5:172837937-172837959 AGCCCTGTGCCCAGGCCCAGTGG + Intronic
1001705715 5:173739928-173739950 ACAGCAGTGCAAAGGCCCTGAGG + Intergenic
1001956866 5:175853749-175853771 AGATCTGTGCTCTGGCCGTGTGG - Intronic
1001995752 5:176156274-176156296 ATAGAGGAGCCCAGGCCCTGCGG + Intergenic
1002077814 5:176719596-176719618 TGAGCCGTGCCCAAGCCCAGGGG - Intergenic
1002089250 5:176794695-176794717 ACAGCCGTGCAAAGGCCCTGTGG - Intergenic
1002094892 5:176824871-176824893 AGGGCAGTGCGCAGGCACTGGGG - Intronic
1002213068 5:177609757-177609779 AGAGCTGGGCCCACGACCTGAGG - Exonic
1002422057 5:179153994-179154016 AGAGCTGACCCCAGGGACTGAGG + Intronic
1002431957 5:179208899-179208921 AGGGCGGTGGCCAGGCCCCGAGG + Intronic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1002876557 6:1215800-1215822 AGAGCTGAGACCGGGCTCTGAGG + Intergenic
1002953485 6:1839503-1839525 GGAGCTGAGCCCAAGCACTGTGG + Intronic
1003015471 6:2463979-2464001 AGAGATTTGGCCAGGCGCTGTGG - Intergenic
1003523082 6:6875219-6875241 AGAGCTGTGGCCGGGCGCGGTGG + Intergenic
1003869672 6:10391435-10391457 AGAGCTGAGCTCTGGCGCTGGGG + Intergenic
1005526808 6:26659461-26659483 AGTGCTGTCCCCAGGCCTAGGGG - Exonic
1006173509 6:32108711-32108733 GCAGCTGAGCCCAGGCTCTGGGG - Intronic
1006189452 6:32198669-32198691 TGTGATGTGCTCAGGCCCTGAGG - Exonic
1006402309 6:33824994-33825016 AGAGCTCAGCCCAGGGACTGGGG - Intergenic
1006699113 6:35957488-35957510 AGAGCTGTTCCCAAGGCTTGAGG + Intronic
1006945747 6:37783556-37783578 AGGGCTGGGCCTGGGCCCTGGGG - Intergenic
1007518194 6:42430023-42430045 ACGGCTGTGCAAAGGCCCTGAGG + Intronic
1007635570 6:43297954-43297976 AGAGCTGGCCCCAGGCCCCAGGG + Intronic
1008661371 6:53671464-53671486 AGAGCTGTGGCTGGGCCATGAGG + Intergenic
1009924001 6:70098107-70098129 ATAGCTGGGGCCAGGGCCTGCGG - Intronic
1010252755 6:73725205-73725227 AGTTCTGCGCCCAGGCACTGGGG - Intronic
1010417429 6:75629010-75629032 AGAACTGTGGCCAGGCACAGTGG - Intronic
1012421433 6:99070105-99070127 AAGGCTGGGGCCAGGCCCTGTGG - Intergenic
1015276316 6:131386507-131386529 AGAGCAGTGGCCAGGCGCGGTGG + Intergenic
1015633002 6:135249662-135249684 AGAGCTGAGCCCAGGCACGATGG - Intergenic
1016462791 6:144295892-144295914 AGAGATGTGCAAAGGCCCTGAGG - Intronic
1016895113 6:149043669-149043691 AGAACTGGCCCGAGGCCCTGAGG + Intronic
1016935246 6:149445082-149445104 AGAGCTGTCCCCAGGAACTCAGG + Intergenic
1017435310 6:154410271-154410293 AGAGGTGAAACCAGGCCCTGGGG + Intronic
1017731822 6:157323665-157323687 CGTGCTGTGCCCAGCCCCAGGGG + Intergenic
1018065631 6:160123424-160123446 AGAGCAATGCTCAGGCCCAGAGG - Intronic
1018859827 6:167703658-167703680 AGAGCTAAGCCCAGGCCTTCAGG - Intergenic
1019170299 6:170129920-170129942 AGAGATGCTTCCAGGCCCTGCGG - Intergenic
1019283545 7:212049-212071 GGGGCTGTGCCCAGGGCCTGGGG + Intronic
1019301948 7:309828-309850 AATGCGGGGCCCAGGCCCTGGGG + Intergenic
1019551384 7:1604370-1604392 GGAGCAGAGCCGAGGCCCTGAGG + Intergenic
1019651158 7:2159327-2159349 AGGGCTGTGCAGAGGACCTGAGG - Intronic
1021261702 7:18466481-18466503 AGGGCTGTGGCCAGGCACAGTGG - Intronic
1022496207 7:30854736-30854758 AGGGCTGTGCCCAGGCCTTCAGG - Intronic
1022535033 7:31093236-31093258 AGAGCTGCCCCGAGGGCCTGTGG - Intronic
1023085558 7:36567097-36567119 AGAGCAGTGGCCAGGCACGGTGG - Intronic
1023805020 7:43866828-43866850 AGATCTGTGCCGTGGTCCTGAGG - Exonic
1023873071 7:44273102-44273124 GGAGCTGTGCCCAGTCCTTGTGG - Intronic
1024046399 7:45588642-45588664 GGACCTGTCCGCAGGCCCTGGGG - Intronic
1024178506 7:46864210-46864232 AGACCTTTTCCCATGCCCTGTGG + Intergenic
1024243235 7:47451215-47451237 GGAGCAGCGCACAGGCCCTGGGG - Intronic
1026079657 7:67206341-67206363 AGAGATGTGGCCAGGCACGGTGG + Intronic
1026231829 7:68490538-68490560 AGAGATGTGGCCAGGCACGGTGG + Intergenic
1026697192 7:72605637-72605659 AGAGATGTGGCCAGGCACGGTGG - Intronic
1027051760 7:75025321-75025343 GGAGTCGGGCCCAGGCCCTGTGG - Intergenic
1029115166 7:98232990-98233012 AGGACAGTGCCCCGGCCCTGAGG - Intronic
1029188902 7:98758348-98758370 ACAGCAGTGCAAAGGCCCTGAGG + Intergenic
1029479518 7:100804056-100804078 AGGGATGTGCCCAGGCCCCGTGG + Intronic
1029712426 7:102307070-102307092 TGAGCTTCGCCCAGGCCCAGGGG - Intronic
1029988917 7:104945320-104945342 TGAGCTAGGCCCAGTCCCTGGGG - Intergenic
1032038176 7:128535418-128535440 AGAGCTGTGACAAGGTGCTGTGG + Intergenic
1032611853 7:133423769-133423791 AGCGCTGCGCGCAGGCCTTGTGG + Intronic
1033727738 7:144137660-144137682 AGAGATGTGGCCAGACACTGAGG - Intergenic
1034199847 7:149277451-149277473 AGAGCTTTGGCCAGGCACAGTGG + Intronic
1034420930 7:150990321-150990343 AGAGCTGTCCCCGGGGCCTTGGG + Intergenic
1034426702 7:151017845-151017867 AGAGCCGTTCCCTGGCCCTGGGG - Intronic
1034890167 7:154832633-154832655 AGCGCTGTTCACAGGCCCTGGGG - Intronic
1034927633 7:155135233-155135255 AGAGTTGTGGCCAGGCACGGTGG + Intergenic
1034982923 7:155490070-155490092 AGATCTGTGCCCAGTGCCGGTGG + Intronic
1035318042 7:158009698-158009720 AGAGCTGTGCCCAGGCAGGAAGG - Intronic
1035535248 8:386136-386158 AGAGCGGTCCCCTGCCCCTGGGG - Intergenic
1035549569 8:510051-510073 AGAGCTGTGCCCACTCCCCAGGG + Intronic
1036787977 8:11700623-11700645 AGACCGGCGCCCAGGCCCAGCGG + Intronic
1037925985 8:22844724-22844746 AGAGGTGTGCCCTGGCCCACTGG + Intronic
1038898110 8:31810529-31810551 ACAGCTGTGCAAAGGCCCTGAGG - Intronic
1039566316 8:38554675-38554697 AGGCCTTTTCCCAGGCCCTGTGG - Intergenic
1041288256 8:56282898-56282920 ACAGCTGTGACCAGGCACGGTGG - Intergenic
1041497689 8:58505027-58505049 AGCCCTGAGCCCTGGCCCTGTGG + Intergenic
1041728024 8:61036357-61036379 AGACCTCTGGCCAGGCTCTGTGG + Intergenic
1042246735 8:66715538-66715560 AAAGCTGTGGCCAGGCACGGTGG - Intronic
1045532814 8:103000668-103000690 AGGGCTGAGCCCAGACCCTGGGG - Intergenic
1046013158 8:108574637-108574659 ATAGCTGTGGCCAGGCACGGTGG + Intergenic
1047353665 8:124099880-124099902 AGAGATGTGCAAAGGCCCCGTGG - Intronic
1047724516 8:127672244-127672266 ACAGCAGTGCATAGGCCCTGAGG - Intergenic
1048330720 8:133468949-133468971 AAAGATGTGCCCAGGCCCAGGGG + Intronic
1048469818 8:134696166-134696188 AGAGATGGGGCCAGGGCCTGGGG - Intronic
1048867535 8:138771840-138771862 AGAGCTCTCCGCAGGCCCCGGGG - Intronic
1048985291 8:139731705-139731727 GGAGCTGTGCCCAGGACAGGGGG - Intronic
1049310949 8:141933603-141933625 AGAGCTCACCCCAGGCTCTGGGG - Intergenic
1049315397 8:141964344-141964366 CCAGCTGTGCCCAGTCCCCGTGG + Intergenic
1049409959 8:142468633-142468655 ACAGCTGTGTGAAGGCCCTGAGG - Intronic
1049541368 8:143210661-143210683 AGACCTTAGCCCTGGCCCTGGGG + Intergenic
1049561824 8:143315923-143315945 AGGCCTGTGCCGAGGCTCTGGGG + Intronic
1051467532 9:17397328-17397350 AGAGCAGTCCCCAGGGGCTGCGG + Intronic
1051897846 9:22007070-22007092 AGAGCTTGGGCCAGGCCCAGTGG + Intronic
1052988693 9:34506025-34506047 AAAGCTGTGCCCAGGTCAAGTGG + Intronic
1053130783 9:35614196-35614218 AGCACTGTGCCCAGGCACTTGGG - Intronic
1053165109 9:35839052-35839074 ACAGCTGAGCCCATGCCCAGAGG - Intronic
1055874378 9:80924557-80924579 AGAGCTGGGCAAAGGCCCTGAGG + Intergenic
1056799260 9:89680116-89680138 AGAGATGTCCCCGGGCACTGTGG + Intergenic
1056967921 9:91179705-91179727 AGAGCAGTGCCCAGCACCTGTGG - Intergenic
1057227980 9:93302458-93302480 AAAGCTCTCCCCAGGCCCTAGGG - Intronic
1057682257 9:97199866-97199888 AGTGCTGTCCCCAGGCCTAGGGG - Intergenic
1058903338 9:109460595-109460617 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1059310687 9:113387197-113387219 GGAGTTGTGCAAAGGCCCTGGGG - Exonic
1059355065 9:113692335-113692357 AGAGCTGTGTGGAGGCCCTTGGG + Intergenic
1059386046 9:113965416-113965438 ATAGCCTTGCCCAGGTCCTGAGG + Intronic
1060010821 9:120041501-120041523 ATGGCTGAGCCCAGGCACTGGGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060758556 9:126229788-126229810 AGAGCTGTGCAAAGGCCCTGAGG + Intergenic
1060938172 9:127527769-127527791 AGAGGCTTGCCCAGGCACTGGGG - Intronic
1061217707 9:129231420-129231442 AGAGCTGTGCCGGGGCCGAGCGG - Intergenic
1061358102 9:130121674-130121696 TGAGCTGTGTTCAGGCCCTTTGG + Intronic
1061398101 9:130354400-130354422 AGAGCTCTGTCCCGGCCCTGGGG + Intronic
1061414536 9:130439170-130439192 AGAGCTGAGGCCAGGCGCGGTGG + Intergenic
1061875349 9:133540821-133540843 GGCGCTGTGGCCAGGCCCCGGGG - Intronic
1061994075 9:134175292-134175314 ACAGCTCTGCAAAGGCCCTGAGG + Intergenic
1062187851 9:135228118-135228140 CCAGCTGTGCAAAGGCCCTGAGG + Intergenic
1062380064 9:136282799-136282821 GGACGTGTGCCCAGGCCGTGAGG + Intronic
1062448548 9:136605996-136606018 AGGCCTGTGCCCAGGCCGGGAGG + Intergenic
1203747106 Un_GL000218v1:45858-45880 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic
1203563002 Un_KI270744v1:73622-73644 AGAGCTGGGCTCTGGCCCAGAGG + Intergenic
1185597065 X:1313699-1313721 GGAGCTGTGGCCAGGCACAGTGG + Intergenic
1186244596 X:7607357-7607379 AGAGATTTGGCCAGGCACTGGGG + Intergenic
1186496576 X:10015979-10016001 CGAGCTCTGCCCGGGCCCGGGGG - Intronic
1187209809 X:17218106-17218128 TGAGGTGTGGCCAGGCACTGTGG - Intergenic
1189170616 X:38905882-38905904 AGAGCTCACCACAGGCCCTGTGG + Intergenic
1189540300 X:41980514-41980536 AGAGATGTTCCTAAGCCCTGTGG - Intergenic
1189781042 X:44514582-44514604 AGGGCTGGGCACAGGCTCTGTGG - Intergenic
1192151690 X:68716714-68716736 AGAGCTGAGACCAGGCCCCATGG - Intronic
1192174573 X:68877853-68877875 GGAGCTGGGCTGAGGCCCTGGGG + Intergenic
1192233977 X:69284681-69284703 CGAGCTGAGACCAGGCCCCGAGG - Intergenic
1192245301 X:69367036-69367058 ACAGTTTTCCCCAGGCCCTGTGG + Intergenic
1197727948 X:129788609-129788631 AGAGCGGTCCCCAGGCCCCCTGG - Intronic
1200049393 X:153420760-153420782 AGAGAGGTGCCCAGGGCTTGGGG + Exonic
1201160425 Y:11160853-11160875 AGAGCTGGGCTCTGGCCCAGAGG - Intergenic
1201290833 Y:12420359-12420381 AGACCTGCGCCCAGGCGCAGTGG + Intergenic