ID: 939189764

View in Genome Browser
Species Human (GRCh38)
Location 2:138902404-138902426
Sequence CTGGAAGGGCGAAACAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 3, 2: 0, 3: 4, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939189764_939189770 -2 Left 939189764 2:138902404-138902426 CCTCGTCTGTTTCGCCCTTCCAG 0: 1
1: 3
2: 0
3: 4
4: 89
Right 939189770 2:138902425-138902447 AGGCATGCCAGCCTTGGCAACGG 0: 1
1: 0
2: 7
3: 34
4: 345
939189764_939189768 -8 Left 939189764 2:138902404-138902426 CCTCGTCTGTTTCGCCCTTCCAG 0: 1
1: 3
2: 0
3: 4
4: 89
Right 939189768 2:138902419-138902441 CCTTCCAGGCATGCCAGCCTTGG 0: 1
1: 0
2: 1
3: 39
4: 347
939189764_939189772 7 Left 939189764 2:138902404-138902426 CCTCGTCTGTTTCGCCCTTCCAG 0: 1
1: 3
2: 0
3: 4
4: 89
Right 939189772 2:138902434-138902456 AGCCTTGGCAACGGCAACACTGG 0: 1
1: 0
2: 0
3: 8
4: 96
939189764_939189774 21 Left 939189764 2:138902404-138902426 CCTCGTCTGTTTCGCCCTTCCAG 0: 1
1: 3
2: 0
3: 4
4: 89
Right 939189774 2:138902448-138902470 CAACACTGGAATGCCAGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939189764 Original CRISPR CTGGAAGGGCGAAACAGACG AGG (reversed) Intergenic
901785469 1:11621812-11621834 CTGGGAGGGCCAAACAGCCTTGG - Intergenic
904401403 1:30259025-30259047 CTGGCAGGGGGACACAGACACGG + Intergenic
904948594 1:34217491-34217513 CTGAAAGAGAGAAACAGAGGTGG + Intronic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
912831551 1:112957480-112957502 CTGGAAGGGAGGAAGACACGAGG - Intergenic
913489694 1:119367489-119367511 CTGGAAGGGAGAGACAGAGTCGG + Intergenic
915364140 1:155304597-155304619 GTGGAACGGCAAAACAGCCGTGG + Intergenic
915939051 1:160106863-160106885 CTGGAAGGGAGAGACTGATGGGG - Intergenic
917448136 1:175123985-175124007 CTGGAAGATGGAAACAGAAGAGG - Intronic
921110838 1:212035304-212035326 CTGAATGGGTGAAACAGGCGTGG - Intronic
921389243 1:214603092-214603114 CCGAAAGGGCCAATCAGACGCGG + Intergenic
921692483 1:218165711-218165733 CGGGAAGGAGGAAATAGACGGGG + Intergenic
923684064 1:236142199-236142221 CGGGAAGGGGGGAAGAGACGCGG + Intergenic
1067455326 10:46415018-46415040 GTGGAAGGGAGAAGCAGAAGAGG + Intergenic
1067631878 10:47969617-47969639 GTGGAAGGGAGAAGCAGAAGAGG - Intergenic
1068962125 10:62877459-62877481 CTGGAGAGGGGAAACAGAAGGGG + Intronic
1075095620 10:119468914-119468936 CTGGAAGGGAGTAAGAGAGGAGG + Intergenic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1081726683 11:45334666-45334688 CTGGCAGGGCAAAATAGATGAGG + Intergenic
1083857297 11:65399595-65399617 AGGGAAGGGAGAAACAGAGGTGG - Intronic
1084115642 11:67041573-67041595 CTGGAAGGGCGTAACAGGAGGGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1090609922 11:128461917-128461939 CTGGGAGGGCAAAAAAGAGGTGG - Exonic
1091058541 11:132441019-132441041 CGGGCAGGGAGAAACAGATGAGG + Intronic
1093479206 12:19587185-19587207 ATGGAAGGGAGAAAGAGAAGAGG + Intronic
1103566621 12:121819381-121819403 CTGGATGGGGGACACAGACGAGG - Intronic
1104419158 12:128621065-128621087 CTGGAAGGGCAAACCAGTCACGG - Intronic
1104475718 12:129068900-129068922 CTGCAAGGGCAAAACAAAGGGGG + Intergenic
1105328315 13:19390717-19390739 CGGGAAGGACCAAACAGACCCGG - Intergenic
1105863548 13:24438808-24438830 CGGGAAGGACCAAACAGACCTGG + Intronic
1113487793 13:110667533-110667555 CTGGAAGGAATAAATAGACGAGG - Intronic
1127515446 15:59689155-59689177 CTGGAGGGGCGAAGAGGACGAGG - Exonic
1129844842 15:78763524-78763546 CTGCCAGGGAGAAACAGACAAGG - Intronic
1130256981 15:82330329-82330351 CTGACAGGGAGAAACAGACAAGG + Intergenic
1130597967 15:85259659-85259681 CTGACAGGGAGAAACAGACAAGG - Intergenic
1131809712 15:96160355-96160377 TTGGAAGGGGGAAAAAGATGAGG - Intergenic
1137552074 16:49444478-49444500 CAGGGAGGGAGAAACAAACGGGG - Intergenic
1151701141 17:75743183-75743205 CTGGAAGGGCCAGGCAGAGGAGG - Intronic
1152104927 17:78323280-78323302 CTGGAGGGAGGAAACAGACCAGG + Intergenic
1152788390 17:82264254-82264276 CTGGGAGGGCTCCACAGACGTGG + Intronic
1152902396 17:82950400-82950422 CTGGAAGAGCGGCACTGACGGGG + Intronic
1159647273 18:70933759-70933781 CTAGAAGGTCAAAACAGACCTGG + Intergenic
1160123670 18:76151651-76151673 CTGCAAGGGCCAGACACACGTGG + Intergenic
1160305924 18:77736562-77736584 CTGGCAGGGCGATGCACACGGGG - Intergenic
1162838739 19:13340159-13340181 CTGAAAGGGAAAAACAGCCGAGG + Intronic
1164050894 19:21585369-21585391 CTGGAAGGTCCAGACAGATGTGG + Intergenic
1165462003 19:35949444-35949466 CTGGAAGGGGGACACACACTTGG + Intergenic
1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG + Intronic
1167279996 19:48561503-48561525 CTGGAAGGGAGAGAGAGAGGAGG + Intronic
925412480 2:3647899-3647921 CTGTAGGGGAGAAACAGACCTGG + Intergenic
926365944 2:12133303-12133325 GTGAAAGGGGGAAACAGAAGAGG - Intergenic
927488035 2:23502617-23502639 CTGGAAGGGCCAAACACGAGGGG - Intronic
935545509 2:104395956-104395978 CTGGAAGGGTGAAACAAGCAAGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
944465183 2:199993603-199993625 GTGGAAGGGGGAAATTGACGAGG + Intronic
945976629 2:216276213-216276235 ATGGAAGGGGGAAACAGTGGAGG - Intronic
947807041 2:232976218-232976240 GTGGAAGGGAGCAACAGAAGAGG - Intronic
948149568 2:235734309-235734331 CTGGAAGGGAGAAAGACAGGAGG - Intronic
948756852 2:240165117-240165139 CTGGAAGGGCGGGACAGTGGTGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173434087 20:43016925-43016947 CTGAAAGGGAGAAACAGAGATGG - Intronic
1175093245 20:56521923-56521945 CAGTAAGGGGCAAACAGACGTGG - Intronic
1181513732 22:23400218-23400240 CTGGATGGGCGAGGCAGGCGTGG + Intergenic
1181672340 22:24431563-24431585 CTGGAAGAGAGAGAGAGACGAGG + Intronic
1182400679 22:30074491-30074513 ATGGAAGGGAGAAAGAGACTTGG - Intergenic
950756654 3:15178790-15178812 CTGTAAGGGAGTAACAGAAGTGG - Intergenic
950861221 3:16149173-16149195 CTGGTAGGATGAAACAGACTGGG + Intergenic
954802434 3:53194881-53194903 CTGCAAGGGCCAAACAGAGCTGG + Intergenic
963383540 3:144561005-144561027 CTGGAAGGGCACAAAAGAGGAGG + Intergenic
976649791 4:87422432-87422454 AAGGAAAGGTGAAACAGACGAGG - Intergenic
980767810 4:137330919-137330941 CAGGAAGTGAGAAACAAACGAGG - Intergenic
981884049 4:149651293-149651315 CTGGAAGGTGGAAATAGATGAGG + Intergenic
984390819 4:179129753-179129775 CTGGAAAGGCCAAAAAGAAGAGG - Intergenic
985676734 5:1235316-1235338 CTGAGATGGAGAAACAGACGTGG - Intronic
993646845 5:90473695-90473717 AGGGAAGGGTGAAACAGAAGTGG + Intronic
998806067 5:145918879-145918901 CTGGAAAAGCCAAACAGACTTGG + Intergenic
1001446697 5:171790772-171790794 CTGGAAGGCAGACACAGAAGTGG - Intronic
1006755658 6:36413045-36413067 CAGGGAGGGTGAAACAGAGGAGG + Intronic
1012038774 6:94176730-94176752 ATGGAAGGAAGAAACAGACAAGG - Intergenic
1013614687 6:111830958-111830980 GTGGAAGTGCAAAACAGAAGGGG + Intronic
1016035140 6:139376190-139376212 CAAGAAGGGGGAAAAAGACGAGG - Intergenic
1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG + Exonic
1022832161 7:34078962-34078984 CTGGAAGGGCGAGGCAGGGGAGG - Exonic
1027809667 7:82879350-82879372 GGGGAAGTGCGGAACAGACGGGG - Exonic
1028986367 7:97012237-97012259 CAGGAAAGGCGAAACAAAAGAGG + Intergenic
1029346186 7:99980457-99980479 CTGGAAGGGCGACACATCCCAGG + Intergenic
1029558991 7:101290058-101290080 CTGGAAGGGCGACACATCCCAGG - Intergenic
1029728292 7:102423034-102423056 GTGGAAGGGAGCAACAGAGGAGG - Intronic
1049787939 8:144460078-144460100 CTGGAAGGTCAACACAGACCTGG - Intronic
1050274968 9:3987193-3987215 CTGGAAGGGCTCAACAGTAGAGG + Intronic
1052739088 9:32376119-32376141 CTGGAAGGGGGATGCAGATGAGG + Intergenic
1053483303 9:38432566-38432588 CTGGAAGGATGATACAGAAGGGG + Intergenic
1056507124 9:87268034-87268056 ATGGAAGGGCGGAAGAGAGGGGG + Intergenic
1056672143 9:88639461-88639483 TTGGAAGGGCACACCAGACGGGG + Intergenic
1057845084 9:98516752-98516774 CTGGTAGCGCTAAACAGACCTGG + Intronic
1187445846 X:19360322-19360344 CTGGAATGGTGAAACAAACAAGG - Exonic