ID: 939194898

View in Genome Browser
Species Human (GRCh38)
Location 2:138959598-138959620
Sequence CAGTGGTAACACTCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939194898_939194903 -8 Left 939194898 2:138959598-138959620 CCCTCCCCAGAGTGTTACCACTG No data
Right 939194903 2:138959613-138959635 TACCACTGTTTTGATTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939194898 Original CRISPR CAGTGGTAACACTCTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr