ID: 939201380

View in Genome Browser
Species Human (GRCh38)
Location 2:139039689-139039711
Sequence CCATTGCCATTATGGGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939201370_939201380 4 Left 939201370 2:139039662-139039684 CCTAAGATGGGATCCATTTCCCC No data
Right 939201380 2:139039689-139039711 CCATTGCCATTATGGGGAATTGG No data
939201369_939201380 5 Left 939201369 2:139039661-139039683 CCCTAAGATGGGATCCATTTCCC No data
Right 939201380 2:139039689-139039711 CCATTGCCATTATGGGGAATTGG No data
939201371_939201380 -9 Left 939201371 2:139039675-139039697 CCATTTCCCCTGACCCATTGCCA No data
Right 939201380 2:139039689-139039711 CCATTGCCATTATGGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939201380 Original CRISPR CCATTGCCATTATGGGGAAT TGG Intergenic
No off target data available for this crispr