ID: 939202021

View in Genome Browser
Species Human (GRCh38)
Location 2:139048240-139048262
Sequence TGTCCACACATGATAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939202016_939202021 30 Left 939202016 2:139048187-139048209 CCATTGCTGGTTAAAGCTCTCTT No data
Right 939202021 2:139048240-139048262 TGTCCACACATGATAGAGGGAGG No data
939202017_939202021 -9 Left 939202017 2:139048226-139048248 CCACCTTCTCACTGTGTCCACAC No data
Right 939202021 2:139048240-139048262 TGTCCACACATGATAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939202021 Original CRISPR TGTCCACACATGATAGAGGG AGG Intergenic
No off target data available for this crispr