ID: 939203415

View in Genome Browser
Species Human (GRCh38)
Location 2:139068595-139068617
Sequence CTATGATGCCTGGCAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939203411_939203415 15 Left 939203411 2:139068557-139068579 CCTGGGGGGAACCATAGTACAGT No data
Right 939203415 2:139068595-139068617 CTATGATGCCTGGCAAAATAAGG No data
939203412_939203415 4 Left 939203412 2:139068568-139068590 CCATAGTACAGTATTTGAAAGTT No data
Right 939203415 2:139068595-139068617 CTATGATGCCTGGCAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939203415 Original CRISPR CTATGATGCCTGGCAAAATA AGG Intergenic
No off target data available for this crispr