ID: 939204021

View in Genome Browser
Species Human (GRCh38)
Location 2:139076737-139076759
Sequence GTTCCATGGGACCAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939204015_939204021 1 Left 939204015 2:139076713-139076735 CCACCAGGGGTGAGCAGCAGTCT No data
Right 939204021 2:139076737-139076759 GTTCCATGGGACCAGGTAGAGGG No data
939204016_939204021 -2 Left 939204016 2:139076716-139076738 CCAGGGGTGAGCAGCAGTCTTGT No data
Right 939204021 2:139076737-139076759 GTTCCATGGGACCAGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939204021 Original CRISPR GTTCCATGGGACCAGGTAGA GGG Intergenic
No off target data available for this crispr