ID: 939204342

View in Genome Browser
Species Human (GRCh38)
Location 2:139080827-139080849
Sequence CCTTACAGGGTGCATTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939204336_939204342 5 Left 939204336 2:139080799-139080821 CCATTTGAGTCCTTTCTGCATAC No data
Right 939204342 2:139080827-139080849 CCTTACAGGGTGCATTAGTCAGG No data
939204337_939204342 -5 Left 939204337 2:139080809-139080831 CCTTTCTGCATACCAGATCCTTA No data
Right 939204342 2:139080827-139080849 CCTTACAGGGTGCATTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939204342 Original CRISPR CCTTACAGGGTGCATTAGTC AGG Intergenic
No off target data available for this crispr