ID: 939204574

View in Genome Browser
Species Human (GRCh38)
Location 2:139083989-139084011
Sequence ACCATTTTTGGTTGAACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939204574_939204582 16 Left 939204574 2:139083989-139084011 CCATTAGTTCAACCAAAAATGGT No data
Right 939204582 2:139084028-139084050 GCCCCCTCTGGCAGTTTTGTGGG No data
939204574_939204581 15 Left 939204574 2:139083989-139084011 CCATTAGTTCAACCAAAAATGGT No data
Right 939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG No data
939204574_939204580 4 Left 939204574 2:139083989-139084011 CCATTAGTTCAACCAAAAATGGT No data
Right 939204580 2:139084016-139084038 AGGGTCACAGGAGCCCCCTCTGG No data
939204574_939204579 -8 Left 939204574 2:139083989-139084011 CCATTAGTTCAACCAAAAATGGT No data
Right 939204579 2:139084004-139084026 AAAATGGTTGGCAGGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939204574 Original CRISPR ACCATTTTTGGTTGAACTAA TGG (reversed) Intergenic
No off target data available for this crispr