ID: 939204581

View in Genome Browser
Species Human (GRCh38)
Location 2:139084027-139084049
Sequence AGCCCCCTCTGGCAGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939204574_939204581 15 Left 939204574 2:139083989-139084011 CCATTAGTTCAACCAAAAATGGT No data
Right 939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG No data
939204578_939204581 3 Left 939204578 2:139084001-139084023 CCAAAAATGGTTGGCAGGGTCAC No data
Right 939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939204581 Original CRISPR AGCCCCCTCTGGCAGTTTTG TGG Intergenic
No off target data available for this crispr