ID: 939208395

View in Genome Browser
Species Human (GRCh38)
Location 2:139139169-139139191
Sequence GCCACCTATAAAATAACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939208393_939208395 26 Left 939208393 2:139139120-139139142 CCTTAAATGAGAAAATGGCATTG No data
Right 939208395 2:139139169-139139191 GCCACCTATAAAATAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939208395 Original CRISPR GCCACCTATAAAATAACCAA AGG Intergenic
No off target data available for this crispr