ID: 939213873

View in Genome Browser
Species Human (GRCh38)
Location 2:139212249-139212271
Sequence GACAGCTCTTGGCCTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939213869_939213873 15 Left 939213869 2:139212211-139212233 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG No data
939213868_939213873 16 Left 939213868 2:139212210-139212232 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG No data
939213870_939213873 11 Left 939213870 2:139212215-139212237 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939213873 Original CRISPR GACAGCTCTTGGCCTGTTAT TGG Intergenic
No off target data available for this crispr