ID: 939217007

View in Genome Browser
Species Human (GRCh38)
Location 2:139251333-139251355
Sequence CAAACTGCTGTCAGTCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939217005_939217007 -3 Left 939217005 2:139251313-139251335 CCTTTAAAAAGGAGTTAAAGCAA No data
Right 939217007 2:139251333-139251355 CAAACTGCTGTCAGTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939217007 Original CRISPR CAAACTGCTGTCAGTCATCT GGG Intergenic
No off target data available for this crispr