ID: 939224986

View in Genome Browser
Species Human (GRCh38)
Location 2:139353697-139353719
Sequence TAGGCTGCACACACACAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939224986_939224996 26 Left 939224986 2:139353697-139353719 CCGTGCTGTGTGTGTGCAGCCTA No data
Right 939224996 2:139353746-139353768 ACTCCAGCTATGGCTAAAATTGG No data
939224986_939224993 16 Left 939224986 2:139353697-139353719 CCGTGCTGTGTGTGTGCAGCCTA No data
Right 939224993 2:139353736-139353758 CATCCCAGCAACTCCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939224986 Original CRISPR TAGGCTGCACACACACAGCA CGG (reversed) Intergenic
No off target data available for this crispr